Question

Compare and contrast among silent, missense, and nonsense mutations (14.2)

Compare and contrast among silent, missense, and nonsense mutations (14.2)

Homework Answers

Answer #1

A silent mutation is that mutation which is caused by the changes which are generally caused by substituting the base pair without any change in the amino acid or its functionality.

Missense mutations are those mutations which are generally caused by substitution of the base pair which can ultimately result into the codon which is going to code for a different amino acid during peptide synthesis thereby altering the protein.

Non sense mutations are those mutations which a point mutation can lead to the coding of a stop codon which can ultimately stop the process of peptide synthesis wherever it is present.

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
Compare and contrast nonsense mutations with suppressor mutations.
Compare and contrast nonsense mutations with suppressor mutations.
Why are temperature-sensitive mutations more likely to involve missense over nonsense mutations?
Why are temperature-sensitive mutations more likely to involve missense over nonsense mutations?
Define the following terms. Mutation Base (pair) substitution Missense mutation Nonsense mutation Silent mutation Frameshift mutation
Define the following terms. Mutation Base (pair) substitution Missense mutation Nonsense mutation Silent mutation Frameshift mutation
1. Three mutations are listed below for the following mRNA at the positions they occur. Using...
1. Three mutations are listed below for the following mRNA at the positions they occur. Using the genetic code on page 304 of your text determine if the mutation causes a silent, missense or nonsense mutation. 5’ AUG GUC UCA GAC CGG UUA 3’ Mutant 1 A in position 12 Mutant 2 A in position 8 Mutant 3 A in position 13 A. nonsense B. silent C. missense
A mutation that changes the amino acid codon into a stop codon are called a.) silent...
A mutation that changes the amino acid codon into a stop codon are called a.) silent b.) missense c.) nonsense d.) insertion
3' GGTTACAACCGATAGCTCTGTATTA 5' the polypeptide for this what? a. silent mutuation b. missense c.nonsense
3' GGTTACAACCGATAGCTCTGTATTA 5' the polypeptide for this what? a. silent mutuation b. missense c.nonsense
Classify the mutations below as transition, transversion, or indel mutations. 1. TGCAATGCC -> TGCAGTGCC 2. TGCAATGCC...
Classify the mutations below as transition, transversion, or indel mutations. 1. TGCAATGCC -> TGCAGTGCC 2. TGCAATGCC -> TTCAATGCC 3. TGCAATGC ->TGCAAT Can any of the mutations above be classified as point mutations? Can any of the mutations above be classified as missense mutations? Can any of the mutations above be classified as nonsense mutations? Can any of the mutations above be classified as a frameshift mutation?
Flag this Question Question 491 pts A neutral missense mutation is a mutation that Group of...
Flag this Question Question 491 pts A neutral missense mutation is a mutation that Group of answer choices Gives rise to another codon, which nonetheless specifies the same amino acid Gives rise to another codon, which specifies a chemically similar amino acid (so that protein function remains unaffected) Gives rise to another codon, which is not translated Flag this Question Question 501 pts Consider the following codon for lysine: 5’-AAA-3’. The DNA is mutated in such a way that this...
if many missense mutations change the nucleotide sequence of the promotor for lac ZYA. Please explain...
if many missense mutations change the nucleotide sequence of the promotor for lac ZYA. Please explain what would happen to the induction of the lac operon when glucose is absent and lactose is present.
Describe the link between protein structure/function, silent mutations, and the conservative nature of the genetic code....
Describe the link between protein structure/function, silent mutations, and the conservative nature of the genetic code. Your answer should contain a definition of silent mutation and an explanation for how the genetic code is conservative.