Question

3' GGTTACAACCGATAGCTCTGTATTA 5' the polypeptide for this what? a. silent mutuation b. missense c.nonsense

3' GGTTACAACCGATAGCTCTGTATTA 5'

the polypeptide for this what?

a. silent mutuation
b. missense
c.nonsense
Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
Compare and contrast among silent, missense, and nonsense mutations (14.2)
Compare and contrast among silent, missense, and nonsense mutations (14.2)
Define the following terms. Mutation Base (pair) substitution Missense mutation Nonsense mutation Silent mutation Frameshift mutation
Define the following terms. Mutation Base (pair) substitution Missense mutation Nonsense mutation Silent mutation Frameshift mutation
A mutation that changes the amino acid codon into a stop codon are called a.) silent...
A mutation that changes the amino acid codon into a stop codon are called a.) silent b.) missense c.) nonsense d.) insertion
What type of mutation is shown? :Wildtype sequence template DNA strand 3’ TACAGTGGGTTC 5’    coding...
What type of mutation is shown? :Wildtype sequence template DNA strand 3’ TACAGTGGGTTC 5’    coding DNA strand 5’ ATGTCACCCAAG 3’    Mutant Sequence: template DNA strand 3’ TACAATGGGTTC 5’ coding DNA strand 5’ ATGTTACCCAAG 3’ a.) a missense mutation b.) a frameshift mutation c.) an exonic mutation d.) a silent mutation e.) a nonsense mutation
1. Three mutations are listed below for the following mRNA at the positions they occur. Using...
1. Three mutations are listed below for the following mRNA at the positions they occur. Using the genetic code on page 304 of your text determine if the mutation causes a silent, missense or nonsense mutation. 5’ AUG GUC UCA GAC CGG UUA 3’ Mutant 1 A in position 12 Mutant 2 A in position 8 Mutant 3 A in position 13 A. nonsense B. silent C. missense
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation...
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation occurred. (insertion, deletion, or substitution) Identify what type of protein change resulted. (frameshift, missense, nonsense, or silent) Normal Sequence 3’ TACCTTCACCGCAGGGTAGCTTTTATTTAA 5’ Mutated sequence 3’ TACCTTCACCGCAGGTAGCTTTTATTTAA 5’
1)  Identify the polypeptide (Using the 3-letter abbreviations for amino acids) that would be produced as a...
1)  Identify the polypeptide (Using the 3-letter abbreviations for amino acids) that would be produced as a result of transcribing and translating the following DNA sequence. DNA: ...3' A C C A A G T C T 5'... 2)  The strand of DNA used above undergoes a mutation, such that the second C from the 3' end is changed to a T. What would change in the polypeptide? 3) List the different codons that can code for arginine.
If the guanine (G) in the DNA sequence 3’ TTACGTTTC is deleted, what are the first...
If the guanine (G) in the DNA sequence 3’ TTACGTTTC is deleted, what are the first 2 amino acids that will be joined at the ribosome? Remember there is a START codon. Use the information on this chart to answer the question. asparagine, alanine methionine, glutamine leucine, glycine leucine, phenylalanine methionine, lysine The mutation in the above question is an example of a ________________ mutation. Group of answer choices frameshift nonsense missense silent
Exposure to a mutagen caused the following DNA change within exon #1 of a gene. What...
Exposure to a mutagen caused the following DNA change within exon #1 of a gene. What type of mutation is this? Wildtype sequence template DNA strand 3’ TACAGTGGGTTC 5’    coding DNA strand 5’ ATGTCACCCAAG 3’    Mutant Sequence template DNA strand 3’ TACAATGGGTTC 5’ coding DNA strand 5’ ATGTTACCCAAG 3 a missense mutation a silent mutation an exonic mutation a frameshift mutation a nonsense mutation
Flag this Question Question 491 pts A neutral missense mutation is a mutation that Group of...
Flag this Question Question 491 pts A neutral missense mutation is a mutation that Group of answer choices Gives rise to another codon, which nonetheless specifies the same amino acid Gives rise to another codon, which specifies a chemically similar amino acid (so that protein function remains unaffected) Gives rise to another codon, which is not translated Flag this Question Question 501 pts Consider the following codon for lysine: 5’-AAA-3’. The DNA is mutated in such a way that this...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT