Question

Define the following terms. Mutation Base (pair) substitution Missense mutation Nonsense mutation Silent mutation Frameshift mutation

  1. Define the following terms.
  1. Mutation
  1. Base (pair) substitution
  1. Missense mutation
  1. Nonsense mutation
  1. Silent mutation
  1. Frameshift mutation

Homework Answers

Answer #1

Mutation - change or alteration of any kind in sequence of DNA including nucleotide number or nucleotide structure.

Base substitution - one kind of nucleotide is changed by other.

Missense mutation - exchange of amino acid by another amino acid due to point mutation which change codon.

Nonsense mutation - it is type of point mutation in which amino acid triplet codon change into stop codon and cause premature termination of transcription.

Silent mutation - type of point mutation in which codon triplet code for same amino acid due to degenerate property of codons.

Frameshift mutation - insertion or deletion of nucleotide which change reading frame of codons and shift in frame of codons is called Frameshift mutation.

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
A base substitution that changed a DNA sequence of TGT to TGG would cause a __________...
A base substitution that changed a DNA sequence of TGT to TGG would cause a __________ mutation. silent nonsense frameshift missense Bacteria that can naturally take up free DNA and recombine it into their chromosome are called ______________. competent F+ cells transduced transformed
Compare and contrast among silent, missense, and nonsense mutations (14.2)
Compare and contrast among silent, missense, and nonsense mutations (14.2)
Q 16, Here is the coding region for two strains of the same bacterial species: Strain...
Q 16, Here is the coding region for two strains of the same bacterial species: Strain 1: 5' - GTACTAACCATATTCACC - 3' Strain 2: 5' - GCTACTAACCATATTCACC - 3' There should only be one correct answer. Thank you! Assume this region is translated. Select the true statement: 1. This is a deletion mutation that results in frameshift. 2. This is a substitution mutation resulting in missense. 3. This is an insertion mutation that is silent. 4. This is an insertion...
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation...
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation occurred. (insertion, deletion, or substitution) Identify what type of protein change resulted. (frameshift, missense, nonsense, or silent) Normal Sequence 3’ TACCTTCACCGCAGGGTAGCTTTTATTTAA 5’ Mutated sequence 3’ TACCTTCACCGCAGGTAGCTTTTATTTAA 5’
A mutation that changes the amino acid codon into a stop codon are called a.) silent...
A mutation that changes the amino acid codon into a stop codon are called a.) silent b.) missense c.) nonsense d.) insertion
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation...
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation occurred. (insertion, deletion, or substitution) Identify what type of protein change resulted. (frameshift, missense, nonsense, or silent) normal sequence- 3' TAC GGA GCA GGG CCA AAA AAC TGT TTT ACT 5´ mutated sequence- 3´ TAC GGA GCA GGG CCA CCA AAC TGT TTT ACT 5´
What type of mutation is shown? :Wildtype sequence template DNA strand 3’ TACAGTGGGTTC 5’    coding...
What type of mutation is shown? :Wildtype sequence template DNA strand 3’ TACAGTGGGTTC 5’    coding DNA strand 5’ ATGTCACCCAAG 3’    Mutant Sequence: template DNA strand 3’ TACAATGGGTTC 5’ coding DNA strand 5’ ATGTTACCCAAG 3’ a.) a missense mutation b.) a frameshift mutation c.) an exonic mutation d.) a silent mutation e.) a nonsense mutation
22. Assume that the third codon within a particular ORF is AGA. Provide a singlebase substitution...
22. Assume that the third codon within a particular ORF is AGA. Provide a singlebase substitution (point mutation) in this codon that causes a missense mutation AND ALSO is classified as a transition mutation? 23. How many possible singlebase substitutions (point mutations) in the codon above would cause a silent mutation? 24. Provide a singlebase substitution (point mutation) in the codon that would cause a nonsense mutation.
Define the term ‘nonsense mutation’ and what causes them.
Define the term ‘nonsense mutation’ and what causes them.
Flag this Question Question 491 pts A neutral missense mutation is a mutation that Group of...
Flag this Question Question 491 pts A neutral missense mutation is a mutation that Group of answer choices Gives rise to another codon, which nonetheless specifies the same amino acid Gives rise to another codon, which specifies a chemically similar amino acid (so that protein function remains unaffected) Gives rise to another codon, which is not translated Flag this Question Question 501 pts Consider the following codon for lysine: 5’-AAA-3’. The DNA is mutated in such a way that this...