Question

A mutation has been introduced into a DNA sequence, but the mutation is silent. What does...

A mutation has been introduced into a DNA sequence, but the mutation is silent. What does this mean?

Homework Answers

Answer #1

A mutation has been introduced into a DNA sequence, but the mutation is silent this means that this type of mutation does not have an observable effect on phenotypes of an organism.

in this type of mutation there is only a chnage in the sequence of nucleotide but the amino acid sequence means the proteins are same. there is no change in the proteins function.

example - within a certain polypeptide ,if the codon AAA is altered to become AAG, the same amino acid that is lysine will be incorporated within a polypeptide chain.

it means that there is only substitution of A at third position by Guanine.but there is no any apparent change in the amino acid after translation.

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
What type of mutation is shown? :Wildtype sequence template DNA strand 3’ TACAGTGGGTTC 5’    coding...
What type of mutation is shown? :Wildtype sequence template DNA strand 3’ TACAGTGGGTTC 5’    coding DNA strand 5’ ATGTCACCCAAG 3’    Mutant Sequence: template DNA strand 3’ TACAATGGGTTC 5’ coding DNA strand 5’ ATGTTACCCAAG 3’ a.) a missense mutation b.) a frameshift mutation c.) an exonic mutation d.) a silent mutation e.) a nonsense mutation
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation...
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation occurred. (insertion, deletion, or substitution) Identify what type of protein change resulted. (frameshift, missense, nonsense, or silent) Normal Sequence 3’ TACCTTCACCGCAGGGTAGCTTTTATTTAA 5’ Mutated sequence 3’ TACCTTCACCGCAGGTAGCTTTTATTTAA 5’
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation...
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation occurred. (insertion, deletion, or substitution) Identify what type of protein change resulted. (frameshift, missense, nonsense, or silent) normal sequence- 3' TAC GGA GCA GGG CCA AAA AAC TGT TTT ACT 5´ mutated sequence- 3´ TAC GGA GCA GGG CCA CCA AAC TGT TTT ACT 5´
A portion of a protein-coding gene is provided for this question. Given the non-template DNA sequence...
A portion of a protein-coding gene is provided for this question. Given the non-template DNA sequence of 5'-TACTATGCTGAGCATTATTGCTAAGTGATGGCTA-3': a. Write the complementary template DNA sequence in a 5' to 3' direction. b. Write the mRNA sequence that would be transcribed from this segment of DNA in a 5' to 3' direction. c. Starting from the first start codon, write the polypeptide sequence that would be translated from the mRNA sequence. d. Define the following terms in your own words: frameshift...
Given a DNA sequence, predict the effect of the resulting protein when there is a mutation...
Given a DNA sequence, predict the effect of the resulting protein when there is a mutation in that sequence.
If the guanine (G) in the DNA sequence 3’ TTACGTTTC is deleted, what are the first...
If the guanine (G) in the DNA sequence 3’ TTACGTTTC is deleted, what are the first 2 amino acids that will be joined at the ribosome? Remember there is a START codon. Use the information on this chart to answer the question. asparagine, alanine methionine, glutamine leucine, glycine leucine, phenylalanine methionine, lysine The mutation in the above question is an example of a ________________ mutation. Group of answer choices frameshift nonsense missense silent
Exposure to a mutagen caused the following DNA change within exon #1 of a gene. What...
Exposure to a mutagen caused the following DNA change within exon #1 of a gene. What type of mutation is this? Wildtype sequence template DNA strand 3’ TACAGTGGGTTC 5’    coding DNA strand 5’ ATGTCACCCAAG 3’    Mutant Sequence template DNA strand 3’ TACAATGGGTTC 5’ coding DNA strand 5’ ATGTTACCCAAG 3 a missense mutation a silent mutation an exonic mutation a frameshift mutation a nonsense mutation
A base substitution that changed a DNA sequence of TGT to TGG would cause a __________...
A base substitution that changed a DNA sequence of TGT to TGG would cause a __________ mutation. silent nonsense frameshift missense Bacteria that can naturally take up free DNA and recombine it into their chromosome are called ______________. competent F+ cells transduced transformed
Most bacterial DNA sequences exist as unique-sequence DNA. What does this mean?
Most bacterial DNA sequences exist as unique-sequence DNA. What does this mean?
11. Assuming that there is a mutation such that the new sequence would be: DNA: TTAGCTAGATAAAACCGGCCCACGTTCTTACTTTT...
11. Assuming that there is a mutation such that the new sequence would be: DNA: TTAGCTAGATAAAACCGGCCCACGTTCTTACTTTT What would be the effect on the sequences of the mRNA & tRNA & the final protein’s sequence? mRNA: transcribe mRNA using the following from the DNA string: T=A, A=U, G & C pair tRNA: transcribe tRNA using the following from the mRNA string: A & U pair, G & C pair Protein: using the Condon chart and the mRNA strand. What I do...