Question

A base substitution that changed a DNA sequence of TGT to TGG would cause a __________...

A base substitution that changed a DNA sequence of TGT to TGG would cause a __________ mutation.

silent

nonsense

frameshift

missense

Bacteria that can naturally take up free DNA and recombine it into their chromosome are called ______________.

competent

F+ cells

transduced

transformed

Homework Answers

Answer #1

–Missense mutation.

Missense mutation is a point mutation where a base pair is substituted by a another which codes for a new amino acid .

Here TGT codes for cysteine and TGG codes for tryptophan , so it changes the amino acid sequence.

– transformed.

Transformation is a method of horizontal gene transfer where bacteria takes up extrachromosomal genetic material and incorporates it into its own genome. So such bacteria get transformed.

If this helps please give it a positive rating thank you!

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation...
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation occurred. (insertion, deletion, or substitution) Identify what type of protein change resulted. (frameshift, missense, nonsense, or silent) normal sequence- 3' TAC GGA GCA GGG CCA AAA AAC TGT TTT ACT 5´ mutated sequence- 3´ TAC GGA GCA GGG CCA CCA AAC TGT TTT ACT 5´
Define the following terms. Mutation Base (pair) substitution Missense mutation Nonsense mutation Silent mutation Frameshift mutation
Define the following terms. Mutation Base (pair) substitution Missense mutation Nonsense mutation Silent mutation Frameshift mutation
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation...
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation occurred. (insertion, deletion, or substitution) Identify what type of protein change resulted. (frameshift, missense, nonsense, or silent) Normal Sequence 3’ TACCTTCACCGCAGGGTAGCTTTTATTTAA 5’ Mutated sequence 3’ TACCTTCACCGCAGGTAGCTTTTATTTAA 5’
What type of mutation is shown? :Wildtype sequence template DNA strand 3’ TACAGTGGGTTC 5’    coding...
What type of mutation is shown? :Wildtype sequence template DNA strand 3’ TACAGTGGGTTC 5’    coding DNA strand 5’ ATGTCACCCAAG 3’    Mutant Sequence: template DNA strand 3’ TACAATGGGTTC 5’ coding DNA strand 5’ ATGTTACCCAAG 3’ a.) a missense mutation b.) a frameshift mutation c.) an exonic mutation d.) a silent mutation e.) a nonsense mutation
If the guanine (G) in the DNA sequence 3’ TTACGTTTC is deleted, what are the first...
If the guanine (G) in the DNA sequence 3’ TTACGTTTC is deleted, what are the first 2 amino acids that will be joined at the ribosome? Remember there is a START codon. Use the information on this chart to answer the question. asparagine, alanine methionine, glutamine leucine, glycine leucine, phenylalanine methionine, lysine The mutation in the above question is an example of a ________________ mutation. Group of answer choices frameshift nonsense missense silent
A portion of a protein-coding gene is provided for this question. Given the non-template DNA sequence...
A portion of a protein-coding gene is provided for this question. Given the non-template DNA sequence of 5'-TACTATGCTGAGCATTATTGCTAAGTGATGGCTA-3': a. Write the complementary template DNA sequence in a 5' to 3' direction. b. Write the mRNA sequence that would be transcribed from this segment of DNA in a 5' to 3' direction. c. Starting from the first start codon, write the polypeptide sequence that would be translated from the mRNA sequence. d. Define the following terms in your own words: frameshift...
Which of the following is false concerning mutations? 1) If a point substitution changed the DNA...
Which of the following is false concerning mutations? 1) If a point substitution changed the DNA so that his RNA codon is made,5'-UGA-3", it would likely have a catastrophic result. 2) Point insertions cause a frame shift 3) Point deletions cause a frame shift 4) If a mutations is silent, only one amino acid of the protein is changed. 5) A frame shift is usually catastrophic. What is it called when RNA is made based on the DNA code? What...
1. Which of these is a genetic mutation that alters a base but does not change...
1. Which of these is a genetic mutation that alters a base but does not change the amino acid? Select one: a. frameshift b. missense c. nonsense d. silent 2. What is the process that occurs when a recipient eukaryote cell accepts DNA fragments indirectly from the surrounding environment? Select one: a. transfection b. transduction c. transformation d. transferal 3. Which type of genetic transfer requires that donor and recipient cells come into contact with each other? Select one: a....
Below is the initial part of the gene sequence for  Glut1 as reported in Flybase. It includes...
Below is the initial part of the gene sequence for  Glut1 as reported in Flybase. It includes the 3' untranslated sequence and the first part of the translated sequence. The promoter for this gene is TATAT. Transcription begins with the third base after the promoter. For each answer portion, in your response, write each one starting on a new line and please write A, B, C, etc. as you go. A)   Transcribe and B). translate this sequence into its final peptide...
1. __________ can cause genes to move from one linkage group to another A. Inversions B....
1. __________ can cause genes to move from one linkage group to another A. Inversions B. Deletions C. UV-light exposure D. Translocations E. Unequal crossing over 2. Transposons that use RNA as an intermediate differ from DNA-only transposons in that the activity of former requires? A. Indirect repeat at one end and direct repeat at the other B. A gene for transposase C. A gene for reverse transcriptase D. A gene for RNA polymerase E. A selectable marker such as...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT
Active Questions
  • Use the given transformation to evaluate the integral. (x − 6y) dA, R where R is...
    asked 6 minutes ago
  • Which document is necessary in establishing outsourcing relationships with an application service provider (ASP)? Service Level...
    asked 15 minutes ago
  • In order to conduct a hypothesis test for the population proportion, you sample 450 observations that...
    asked 21 minutes ago
  • Doctor’s Order: Vancomycin 500mg tab i po q12h X 7 days Available: Vancomycin 500mg tablets What...
    asked 34 minutes ago
  • Calculate the ΔG∘rxn for the reaction using the following information. 4HNO3(g)+5N2H4(l)→7N2(g)+12H2O(l) ΔG∘f(HNO3(g)) = -73.5 kJ/mol; ΔG∘f(N2H4(l))...
    asked 35 minutes ago
  • Question 03: Saturn Shoes (Pvt.) Ltd manufacture multi-style fashion boots for the residents of Missouri. Leather...
    asked 37 minutes ago
  • A highway with a design speed of 100 km/hr is designed with a sag curve connecting...
    asked 49 minutes ago
  • Shift Registers can be used for serial/parallel interface applications. True or false?
    asked 1 hour ago
  • Scenario 1: To describe the instructors’ experience, the researcher records the year in which each instructor...
    asked 1 hour ago
  • develop a flowchart or pseudocode to check the prime numbers 1- below 100 what to do...
    asked 1 hour ago
  • Which of the following statements are true? I. The sampling distribution of ¯xx¯ has standard deviation...
    asked 1 hour ago
  • Which of the following methods of reporting cash flows provided by operating activities does the Financial...
    asked 1 hour ago