Question

Most bacterial DNA sequences exist as unique-sequence DNA. What does this mean?

Most bacterial DNA sequences exist as unique-sequence DNA. What does this mean?

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

Answere : Prokaryotic genomes consist of mostly unique DNA sequences coding for functional protein. Unique-sequence DNA is a sequences that are present only once or, a few times in the genome of organism. Most of the genes that encode proteins are consist of this type of unique sequence. It is usually a single-copy sequences which present in one to a few copies in the genome.

Different types of DNA sequences exist in organisms such as unique-sequence DNA, moderately repetitive sequence and highly repetitive DNA sequences. It depends on how much times a DNA sequence present in a genome.

But in most of bacteria, DNA sequences exist as unique-sequence DNA.

Please rate the answere...

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
what does the sentence "the sequences that comprise the genes constitute most of a bacterial genome...
what does the sentence "the sequences that comprise the genes constitute most of a bacterial genome "
What is the structure of telomeres? Long, unique DNA sequences found at the end of linear...
What is the structure of telomeres? Long, unique DNA sequences found at the end of linear eukaryotic chromosomes. Short, repetitive DNA sequences found at the end of linear eukaryotic chromosomes. Short, repetitive DNA sequences found at the end of linear prokaryotic chromosomes. Long, repetitive DNA sequences found at the end of linear eukaryotic chromosomes.
How does RNA polymerase bind DNA? which subunit binds first? Provide the sequence of a bacterial...
How does RNA polymerase bind DNA? which subunit binds first? Provide the sequence of a bacterial promoter sequence What are the differences between TRP operon and Lac operon?
Given the following prokaryote sequence of DNA: Identify if any promoter sequences are present in DNA...
Given the following prokaryote sequence of DNA: Identify if any promoter sequences are present in DNA SEQ1 (Highlight/Underline these in the sequence) Predict the mRNA sequence that would arise from this DNA sequence. Identify the ribosome binding site, start and stop codons (if present). (Highlight/Underline these in the sequence). Predict the sequence of the peptide that would arise from the predicted mRNA sequence using the genetic code table (see Codon usage table). Based on your knowledge of the properties of...
The following template sequence of DNA was isolated from a bacterial cell. Identify the promoter region...
The following template sequence of DNA was isolated from a bacterial cell. Identify the promoter region (assume there is no operator) and transcribe the DNA to the right of the promoter. Once you’ve transcribed the DNA into mRNA, find the start codon and translate the sequence into the correct amino acids to create a polypeptide. 3’-AATATTTATTATATAACCCGGCATACGTTCGGACGTCCCATATAGACTCCATTCGACTT-5’
A mutation has been introduced into a DNA sequence, but the mutation is silent. What does...
A mutation has been introduced into a DNA sequence, but the mutation is silent. What does this mean?
Transcribe and translate the following bacterial template DNA strand TACCCCAACTACCATATACTTCAAGAAATC mRNA Sequence: Protein Primary structure:
Transcribe and translate the following bacterial template DNA strand TACCCCAACTACCATATACTTCAAGAAATC mRNA Sequence: Protein Primary structure:
What is the role of TFIID in eukaryotic transcription? To what DNA sequence does it bind?
What is the role of TFIID in eukaryotic transcription? To what DNA sequence does it bind?
Which of the following DNA sequences is MOST LIKELY to be a restriction enzyme site? TAGACT...
Which of the following DNA sequences is MOST LIKELY to be a restriction enzyme site? TAGACT CTCGAG TTAGCC GCTGAC
In the course of the Drosophila melanogaster genome project, the following genomic DNA sequences were obtained....
In the course of the Drosophila melanogaster genome project, the following genomic DNA sequences were obtained. Try to assemble the sequences into a single contig. 5? TTCCAGAACCGGCGAATGAAGCTGAAGAAG 3? 5? GAGCGGCAGATCAAGATCTGGTTCCAGAAC 3? 5? TGATCTGCCGCTCCGTCAGGCATAGCGCGT 3? 5? GGAGAATCGAGATGGCGCACGCGCTATGCC 3? 5? GGAGAATCGAGATGGCGGACGCGCTATGCC 3? 5? CCATCTCGATTCTCCGTCTGCGGGTCAGAT 3? Using the assembled sequence, perform a blastn search using the “nucleotide collection (nr/nt)” database. Does the search produce sequences similar to your assembled sequence, and if so, what are they? Can you tell if your sequence is...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT