Question

A portion of a protein-coding gene is provided for this question. Given the non-template DNA sequence...

A portion of a protein-coding gene is provided for this question. Given the non-template DNA sequence of 5'-TACTATGCTGAGCATTATTGCTAAGTGATGGCTA-3':

a. Write the complementary template DNA sequence in a 5' to 3' direction.

b. Write the mRNA sequence that would be transcribed from this segment of DNA in a 5' to 3' direction.

c. Starting from the first start codon, write the polypeptide sequence that would be translated from the mRNA sequence.

d. Define the following terms in your own words: frameshift mutation, point mutation, missense mutation, nonsense mutation, silent mutation, transition mutation, transversion mutation.

e. An individual is exposed to a chemical mutagen and has a change in their DNA so that the non-template sequence is now 5'-TACTATGCTGAGCACTATTGCTAAGTGATGGCTA-3'.

a. Which type(s) of mutations fit this change in the given DNA sequence? Explain your choice based on the sequence change and on your definitions above.

b. Write the new polypeptide sequence that would be produced from this change, beginning from the first start codon.

c. Since this mutation occurred later in life within a cell in the individual's kidney, will the mutation be heritable? Explain your answer.

Homework Answers

Answer #1

Given the DNA sequence is

5'-TACTATGCTGAGCATTATTGCTAAGTGATGGCTA-3'

a. The complementary DNA sequence will be:

         3’- ATGATACGACTCGTAATAACGATTCACTACCGAT-5’

          Thus the strand in 5’ to 3’ direction will be:

      5’- TAGCCATCACTTAGCAATAATGCTCAGCATAGTA-3’

-------------------------------------------------------------------------------------

b. mRNA sequence in 5’ to 3’ direction will be:

5’ – UACUAUGCUGAGCAUUAUUGCUAAGUGAUGGCUA-3’

it will be same as the non template strand, only T will be replaced by U.

------------------------------------------------------

C. The polypeptide sequence from the first start codon AUG will be:

5’ – UACUAUGCUGAGCAUUAUUGCUAAGUGAUGGCUA-3’

Met-Leu-Ser-Ile-Ile-Ala-Lys-Stop

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
Exposure to a mutagen caused the following DNA change within exon #1 of a gene. What...
Exposure to a mutagen caused the following DNA change within exon #1 of a gene. What type of mutation is this? Wildtype sequence template DNA strand 3’ TACAGTGGGTTC 5’    coding DNA strand 5’ ATGTCACCCAAG 3’    Mutant Sequence template DNA strand 3’ TACAATGGGTTC 5’ coding DNA strand 5’ ATGTTACCCAAG 3 a missense mutation a silent mutation an exonic mutation a frameshift mutation a nonsense mutation
What type of mutation is shown? :Wildtype sequence template DNA strand 3’ TACAGTGGGTTC 5’    coding...
What type of mutation is shown? :Wildtype sequence template DNA strand 3’ TACAGTGGGTTC 5’    coding DNA strand 5’ ATGTCACCCAAG 3’    Mutant Sequence: template DNA strand 3’ TACAATGGGTTC 5’ coding DNA strand 5’ ATGTTACCCAAG 3’ a.) a missense mutation b.) a frameshift mutation c.) an exonic mutation d.) a silent mutation e.) a nonsense mutation
During cell division, DNA undergoes replication. DNA is transcribed into mRNA and the genetic code is...
During cell division, DNA undergoes replication. DNA is transcribed into mRNA and the genetic code is translated into a polypeptide sequence. Out of these three processes, which is most likely to be the site a deletion, frameshift, insertion missense, nonsense, point and silent mutation or alteration occurred? Explain why you have chosen this process.
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the...
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the mRNA molecule? The following sequence is located in the middle of an mRNA molecule past the first start codon, so that it is written in the correct reading frame (the first three nucleotides are the first codon, etc.) 5’ – UGC CUG ACA UGC AUC ACG UGG G – 3’. Translate this into a polypeptide (write the amino acid sequence), starting at the beginning...
The following template sequence of DNA was isolated from a bacterial cell. Identify the promoter region...
The following template sequence of DNA was isolated from a bacterial cell. Identify the promoter region (assume there is no operator) and transcribe the DNA to the right of the promoter. Once you’ve transcribed the DNA into mRNA, find the start codon and translate the sequence into the correct amino acids to create a polypeptide. 3’-AATATTTATTATATAACCCGGCATACGTTCGGACGTCCCATATAGACTCCATTCGACTT-5’
A DNA template has the following sequence: 5’-GCTTACTGGCCCGGTTTATTGCCCATCGCC-3’ Infer a transcribed mRNA sequence first, identify the...
A DNA template has the following sequence: 5’-GCTTACTGGCCCGGTTTATTGCCCATCGCC-3’ Infer a transcribed mRNA sequence first, identify the start codon, and determine the complete amino acid sequence that would be translated. Be specific about the amino-terminus and carboxyl-terminus.
If the guanine (G) in the DNA sequence 3’ TTACGTTTC is deleted, what are the first...
If the guanine (G) in the DNA sequence 3’ TTACGTTTC is deleted, what are the first 2 amino acids that will be joined at the ribosome? Remember there is a START codon. Use the information on this chart to answer the question. asparagine, alanine methionine, glutamine leucine, glycine leucine, phenylalanine methionine, lysine The mutation in the above question is an example of a ________________ mutation. Group of answer choices frameshift nonsense missense silent
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation...
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation occurred. (insertion, deletion, or substitution) Identify what type of protein change resulted. (frameshift, missense, nonsense, or silent) Normal Sequence 3’ TACCTTCACCGCAGGGTAGCTTTTATTTAA 5’ Mutated sequence 3’ TACCTTCACCGCAGGTAGCTTTTATTTAA 5’
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation...
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation occurred. (insertion, deletion, or substitution) Identify what type of protein change resulted. (frameshift, missense, nonsense, or silent) normal sequence- 3' TAC GGA GCA GGG CCA AAA AAC TGT TTT ACT 5´ mutated sequence- 3´ TAC GGA GCA GGG CCA CCA AAC TGT TTT ACT 5´
Flag this Question Question 491 pts A neutral missense mutation is a mutation that Group of...
Flag this Question Question 491 pts A neutral missense mutation is a mutation that Group of answer choices Gives rise to another codon, which nonetheless specifies the same amino acid Gives rise to another codon, which specifies a chemically similar amino acid (so that protein function remains unaffected) Gives rise to another codon, which is not translated Flag this Question Question 501 pts Consider the following codon for lysine: 5’-AAA-3’. The DNA is mutated in such a way that this...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT