Question

Determine whether there is a tendency for repeats of the C nucleotide in the following sequence....

Determine whether there is a tendency for repeats of the C nucleotide in the following
sequence. The sequence is 368 nucleotides long. Assume equal probability nucleotides. (3 points)
AGCTCGACTAGCTGGCGCGCTAGCTAGCTAGCGCGCGCGCTAGAGGAGAGCGC
TCGAAGCTAGCTAGCTAGCGAGAGAGAGGGGAGCGGCGCGATAGGCGCCGTC
GCGCGAGAGACACTCCCGAGGAGACCAGGAGAGAGAGAGCGGCGCGAGATGG
GCTCGATCGATGAAAACAAGGGCCTGGTCACACACAGGGGGGTTCTCAGGCTA
GCGCTCGCGAGAGCTCGAGCGCTAGCGCTAGAGCTACAGATCGCGAGAGCGCG
CCCGCGATAGAGCGAGCTAGAGCTAGCTAGATCGGGACATAGATCGGGGCTAG
CTAGCTAGATGGGGATAGGACGAGGGGCGACGAGCGAGAGCGTTGTAGATGT

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

Please give a thumbs up.

In the following given sequence of 368 nucleotides it is given that the probability of each nucleotide is equal.since there are four nucleotides in the sequence the probability of each would be 0.25.

Now upon counting the c nucleotides in the sequence .... There are 83 of them. The probability of c nucleotides in this sequence is now 83/368= 0.225. we know that it should be e 0.25 according to what is given in the given. But here the probability is less than that. So there is definitely no tenancy of of repeating of c nucleotide in the following sequence.

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
1.When a protein binds to DNA at a site defined by a particular nucleotide sequence, with...
1.When a protein binds to DNA at a site defined by a particular nucleotide sequence, with which parts of the DNA does the protein primarily interact? A. the phosphate and deoxyribose groups in the DNA backbone B. the phosphate and deoxyribose groups in the DNA backbone, and hydrophobic interactions with the nucleotide bases C. nucleotide bases within the major grooves of the DNA D. nucleotide bases within the major and minor grooves of the DNA E. none of the above...
For DNA gene sequence TACGTTCAGCAATTT… a. mRNA codons? b. aa sequence? LOOK FOR A GENETIC CODE...
For DNA gene sequence TACGTTCAGCAATTT… a. mRNA codons? b. aa sequence? LOOK FOR A GENETIC CODE TABLE TO DO THIS PART 2. Which of the following molecules is (are) produced by transcription? a. Ribosomal RNA b. Ribosomal proteins c. Messenger RNA d. Transfer RNA 3. Which of the following molecules is (are) produced by translation? a.The amino acid glycine b.Ribosomal proteins c.Transfer RNA d.The digestive enzyme pepsin e.RNA polymerase f.Ribozymes 4. Which of the following mutations would likely be most...
Question: For the zero order hidden Markov model defined in homework 3 determine the probability of...
Question: For the zero order hidden Markov model defined in homework 3 determine the probability of coding state at the last nucleotide of the sequence AGTAG. Use parameters provided in the homework solution (posted in course content). Show all of your work. HW3 solution: Zero order Markov model is described by P(i) = ni/N, where i  = {A,T,G,C}, ni  – the number of times nucleotide i occurred in the sequence N – total number of nucleotides in the sequence (sequence length) P(A)...
Determine whether the following sequences converge or diverge. If a sequence converges, find its limit. If...
Determine whether the following sequences converge or diverge. If a sequence converges, find its limit. If a sequence diverges, explain why. (a) an = ((-1)nn)/ (n+sqrt(n)) (b) an = (sin(3n))/(1- sqrt(n))
Determine whether the sequence converges or diverges. If it converges, find the limit. (If an answer...
Determine whether the sequence converges or diverges. If it converges, find the limit. (If an answer does not exist, enter DNE.) a n = n 3 /n + 2
Determine whether the sequence a_n = (3^n + 4^n)^(1/n) diverges or converges
Determine whether the sequence a_n = (3^n + 4^n)^(1/n) diverges or converges
A consensus sequence is a series of bases or types of bases commonly found at a...
A consensus sequence is a series of bases or types of bases commonly found at a specific position in the genomes of multiple individuals. The two types of bases are purines (R) and pyrimidines (Y). The following table shows the nucleotide sequence of a region of gene X from six different individuals. Nucleotide positions are labeled 1 through 7. A A T A G T A A A T T A T A A C C T G T T...
1. What determines the sequence of nucleotides on the newly synthesized strands during DNA replication? a....
1. What determines the sequence of nucleotides on the newly synthesized strands during DNA replication? a. the nucleotide sequence of the template strand b. the way that the parental DNA strands are untangled by topoisomerase. c. the genetic code, as specified by the RNA reading frame d. the nucleotide sequence of the coding strand 2. A difference between meiosis and mitosis is that_________. a. DNA replication occurs twice in meiosis but only once in mitosis b. sister chromosomes are always...
Determine whether or not the following sets are perfect and whether or not the following sets...
Determine whether or not the following sets are perfect and whether or not the following sets are connected. Show work. a) [0,7) U (7,10] b) [1,3] U [4,8] c) {1, 1/2, 2/3, 3/4, ...}
A neurological disease, spinocerebellar ataxia Type 1, is caused by a dominant allele of an autosomal...
A neurological disease, spinocerebellar ataxia Type 1, is caused by a dominant allele of an autosomal polyQ-type triplet repeat gene called SCA1. Normal SCA1 alleles contain between 6-35 CAG repeats; pre-mutation alleles contain between 36-48 CAG repeats; and disease alleles contain between 49-88 CAG repeats. To determine whether or not you have a SCA1 pre-mutation allele, you prepare genomic DNA from some of your cheek cells and amplify the smallest possible region of your genome that contains the SCA1 gene...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT