Question

A neurological disease, spinocerebellar ataxia Type 1, is caused by a dominant allele of an autosomal polyQ-type triplet repeat gene called SCA1. Normal SCA1 alleles contain between 6-35 CAG repeats; pre-mutation alleles contain between 36-48 CAG repeats; and disease alleles contain between 49-88 CAG repeats.

To determine whether or not you have a SCA1 pre-mutation allele, you prepare genomic DNA from some of your cheek cells and amplify the smallest possible region of your genome that contains the SCA1 gene CAG repeats. You determine the sizes of the PCR products by gel electrophoresis.

1. The sequence bellow shows the coding DNA strand flanking the CAG repeats of the SCA1 gene. Please give the sequence, 5’ to 3’, of two 20-nt PCR primers that you would use to generate the smallest possible diagnostic PCR product. (3 points)

5’ GAGCCAGACGCCGGGACACAAGGCTGAG – (CAG)^X – GGCTCCGGGGCTCATCACCCCGGGGTCCCCC 3’

2. Assume you are heterozygous for a pre-mutation allele and a normal allele. You run your PCR products on an agarose gel. How many bands would you expect to see and what would their approximate size be in base pairs? (2 points)

Answer 1

The primers generated based on the sequence given will be:

forward primer: 5'-GAGCCAGACGCCGGGACACA-3'

reverse primer: 5'-GGGGGACCCCGGGGTGATGA-3'

For heterozygous individuals, when you run the PCR product on agarose gel, two bands will be shown. One band will have the normal allele length (which will be at maximum {[35*3]+40=145bp} and the other band will have the pre-mutant allele length (which will be at maximum {[48*3]+40=186bp} The band sizes are approximate values as the copies of CAG varies in both normal and premutant allele.

if you have any query kindly comment before giving thumbs up. Thank you.