Question

Since spliceosomes increase the diversity of mature RNA which leads to diversities in the sequence of...

Since spliceosomes increase the diversity of mature RNA which leads to diversities in the sequence of amino acids, would this refute the one gene-one polypeptide hypothesis?

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

Yes according to the hypothesis one gene codes for only single polypeptide. That is the the modified version of the sentence one gene one enzyme concept. Due to spliceosomes there will be alternate splicing which leads to made up of different proteins from a single gene .where the mature RNA produces different types of proteins by skipping only certain exons .Where in eukaryotes the one gene majorly produces many proteins by splicing process.So the one gene one polypeptide statement isis hence proven wrong.

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
(2) Below is the entire transcribed RNA sequence of a prokaryotic gene. 5 GCAUAGCAAAUGAGCAUCAUGUGUCAAUGAGGCGAUG 3 (a)...
(2) Below is the entire transcribed RNA sequence of a prokaryotic gene. 5 GCAUAGCAAAUGAGCAUCAUGUGUCAAUGAGGCGAUG 3 (a) Find the protein-coding sequence and provide the amino acid sequence of the encoded protein (b) Which amino acid is at the C-terminus of this peptide?
Which of the following provides the information necessary to specify a protein’s 3-D shape? A) sequence...
Which of the following provides the information necessary to specify a protein’s 3-D shape? A) sequence of amino acids in the polypeptide chain. B) side chains of various amino acids. C) number of water molecules in the vicinity. D) peptide bonds between different amino acids.
1. To initiate transcription, RNA polymerase must recognize the ____ sequence on DNA. 2. Ribosomal 30S...
1. To initiate transcription, RNA polymerase must recognize the ____ sequence on DNA. 2. Ribosomal 30S subunit binds to mRNA by recognizing ______ sequence upstream of the start codon. (Full name for full credit) 3. A special initiator tRNA called ______ binds to the ______ site of the 70S ribosome for base pairing with the ATG start codon. 4. If RNA polymerase transcribes a long mRNA encoding more than one polypeptide, it is called a (an) _______ RNA. 5. Some...
Which of the following mechanisms is NOT involved in the generation of antibody diversity? Somatic hypermutation...
Which of the following mechanisms is NOT involved in the generation of antibody diversity? Somatic hypermutation Recombination with excision of DNA between a V gene sequence and a J sequence Transposition Splicing out of RNA sequences between a J region and a C region Non-homologous end joining and DNA repair
For DNA gene sequence TACGTTCAGCAATTT… a. mRNA codons? b. aa sequence? LOOK FOR A GENETIC CODE...
For DNA gene sequence TACGTTCAGCAATTT… a. mRNA codons? b. aa sequence? LOOK FOR A GENETIC CODE TABLE TO DO THIS PART 2. Which of the following molecules is (are) produced by transcription? a. Ribosomal RNA b. Ribosomal proteins c. Messenger RNA d. Transfer RNA 3. Which of the following molecules is (are) produced by translation? a.The amino acid glycine b.Ribosomal proteins c.Transfer RNA d.The digestive enzyme pepsin e.RNA polymerase f.Ribozymes 4. Which of the following mutations would likely be most...
Which RNA will determine the amino acid sequence? A)dRNA B)tRNA C)mRNA D)rRNA
Which RNA will determine the amino acid sequence? A)dRNA B)tRNA C)mRNA D)rRNA
2. The results of the RNA sequencing experiments are raw transcript reads with no sequence identification....
2. The results of the RNA sequencing experiments are raw transcript reads with no sequence identification. The sequence reads correspond to various genes. A. Describe how you would identify unknown sequence reads. B. How would you amplify and isolate just one of the target sequences from the RNA sequencing experiment? Include both computer and wet lab methods you would use to identify and isolate a single target gene.
Which would be the best choice, from only the options below, to determine the evolutionary relationship...
Which would be the best choice, from only the options below, to determine the evolutionary relationship between two unknown self-replicating organisms (Think about what criteria were needed to accurately assess evolutionary relationships): Group of answer choices Nucleic acid sequence of a cell wall protein RNA dependent RNA polymerase gene DNA sequence of a DNA polymerase gene amino acid sequence of a flagellar protein mRNA sequence of a membrane protein
The transcription of a gene involves copying DNA nucleotides from DNA into a sequence of RNA...
The transcription of a gene involves copying DNA nucleotides from DNA into a sequence of RNA nucleotides. Many regulatory factors can help facilitate the transcription processes. One region that affects transcription is the terminator region, which is located on mRNA, downstream of the coding segment on DNA, in the 5' end of the gene on DNA, downstream of the coding segment on mRNA at the 5' end on DNA, within the coding region
A codon is a series of three bases in mRNA which is equivalent to the 3...
A codon is a series of three bases in mRNA which is equivalent to the 3 bases in DNA; this triplet code corresponds to one amino acid. Once the mRNA is attached to a ribosome, it can assemble the protein by translating from the “language” of nucleic acids to the “language” of amino acids. What is the processed called? In order to synthesize a protein molecule, amino acids need to be aligned in the proper sequence along the RNA sequence....
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT