Question

(2) Below is the entire transcribed RNA sequence of a prokaryotic gene. 5 GCAUAGCAAAUGAGCAUCAUGUGUCAAUGAGGCGAUG 3 (a)...

(2) Below is the entire transcribed RNA sequence of a prokaryotic gene.

5 GCAUAGCAAAUGAGCAUCAUGUGUCAAUGAGGCGAUG 3

(a) Find the protein-coding sequence and provide the amino acid sequence of the encoded protein

(b) Which amino acid is at the C-terminus of this peptide?

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
A DNA template has the following sequence: 5’-GCTTACTGGCCCGGTTTATTGCCCATCGCC-3’ Infer a transcribed mRNA sequence first, identify the...
A DNA template has the following sequence: 5’-GCTTACTGGCCCGGTTTATTGCCCATCGCC-3’ Infer a transcribed mRNA sequence first, identify the start codon, and determine the complete amino acid sequence that would be translated. Be specific about the amino-terminus and carboxyl-terminus.
Shown below is DNA sequence on the coding strand for a structural gene. 5'-AGGACTAAATGACATGGACACTAACTAGTTGGAAGCTAACCC... -3' How...
Shown below is DNA sequence on the coding strand for a structural gene. 5'-AGGACTAAATGACATGGACACTAACTAGTTGGAAGCTAACCC... -3' How many amino acids does the polypeptide encoded by this sequence contain? A. 7 B. 8 C. 6 D. 12 E. 10
4. Which statement describes the central dogma of biology? a) DNA is transcribed into RNA. RNA...
4. Which statement describes the central dogma of biology? a) DNA is transcribed into RNA. RNA is translated into an amino acid sequence. b) Translation is the process of synthesizing RNA from DNA. Transcription is the process of synthesizing an amino acid sequence from RNA. c) Transcription is the process of synthesizing DNA from RNA. Translation is the process of synthesizing an amino sequence from DNA. d) DNA is transcribed to an amino acid sequence. RNA is translated to an...
Prokaryotic polypeptides that end in the amino acid sequence ANDENYALAA will be destroyed. Where does the...
Prokaryotic polypeptides that end in the amino acid sequence ANDENYALAA will be destroyed. Where does the information for this sequence originate? Group of answer choices It is encoded within the gene that codes for that polypeptide. It is attached by the Ski7 protein when it recognizes that the protein is misfolding. It is added by a suppressor tRNA. It is encoded by the tmRNA molecule.
Using this sequence: 5’ AUG GAG AGC CUU GUC CCU 3’ find: a) The translation product,...
Using this sequence: 5’ AUG GAG AGC CUU GUC CCU 3’ find: a) The translation product, indicating the N terminus and the C terminus, and using the one-letter code for amino acids b) The complementary non-coding RNA sequence that will serve as a template to the synthesis of other viral genomes, indicating the 5’ and 3’ ends
A) Complete the following diagram by giving the template sequence, the mRNA sequence and peptide sequence.(The...
A) Complete the following diagram by giving the template sequence, the mRNA sequence and peptide sequence.(The genetic code is provided below)Complete the following diagram by giving the template sequence, the mRNA sequence and peptide sequence.(The genetic code is provided below) Coding:            5’ GCT GAT CAG CTG ACC GAA GAA CAG ATT 3’ Template:     3’ ___ ___ ___   ___ ___ ___ ___   ___ ___ 5’ mRNA:            5’ ___ ___ ___ ___ ___ ___ ___   ___ ___ 3’ Protein:                  N   ...
1.What are the building blocks of nucleic acids? 2.What are the 3 components of these building...
1.What are the building blocks of nucleic acids? 2.What are the 3 components of these building blocks ? 3.How is RNA different from DNA? Give three specific reasons. a._______________________________________________ b._______________________________________________ c._______________________________________________ 4.What are the three types of RNA found in a cell, what is the function of each and are these translated? RNA Function Translated? a. b. c. 5.What is a codon? a. Anticodon? Each of the following questions asks you to work out a sequence of nucleotide bases. When...
5' AGTTGTATAGAAAACTGCGAA 3' What DNA sequence (give as 5' to 3') would be formed by replicating...
5' AGTTGTATAGAAAACTGCGAA 3' What DNA sequence (give as 5' to 3') would be formed by replicating the sequence shown above? What RNA sequence (give as 5' to 3') would be formed by transcribing the sequence formed in part 1? What protein sequence (give as N to C terminus) would be formed by translating the sequence formed in part 2?
Here’s an uncompleted table of a segment of the transcribed region of a gene in a...
Here’s an uncompleted table of a segment of the transcribed region of a gene in a prokaryote. Fill in the empty slots of this table with the appropriate nucleotide/amino acid based on the information you have here. (This requires that you use your awesome knowledge from previous weeks in this unit as well, but you can do it! I know this is challenging, but it’s not impossible. You have enough information here to crack this thing wide open.) DNA double...
Q2 An open reading frame (ORF) is a section of codons that begins with a start...
Q2 An open reading frame (ORF) is a section of codons that begins with a start codon and ends with a stop codon. Each codon specifies for a specific amino acid. ORF is the part of a gene that after transcription into an mRNA gets translated into a protein. With the help of several translation factors and enzymes, ribosomes translate mRNAs into proteins. The following DNA sequence contains a complete open reading frame (ORF) of a short transcriptional unit. The...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT