Question

(2) Below is the entire transcribed RNA sequence of a prokaryotic gene. 5 GCAUAGCAAAUGAGCAUCAUGUGUCAAUGAGGCGAUG 3 (a)...

(2) Below is the entire transcribed RNA sequence of a prokaryotic gene.

5 GCAUAGCAAAUGAGCAUCAUGUGUCAAUGAGGCGAUG 3

(a) Find the protein-coding sequence and provide the amino acid sequence of the encoded protein

(b) Which amino acid is at the C-terminus of this peptide?

Homework Answers

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
Shown below is DNA sequence on the coding strand for a structural gene. 5'-AGGACTAAATGACATGGACACTAACTAGTTGGAAGCTAACCC... -3' How...
Shown below is DNA sequence on the coding strand for a structural gene. 5'-AGGACTAAATGACATGGACACTAACTAGTTGGAAGCTAACCC... -3' How many amino acids does the polypeptide encoded by this sequence contain? A. 7 B. 8 C. 6 D. 12 E. 10
4. Which statement describes the central dogma of biology? a) DNA is transcribed into RNA. RNA...
4. Which statement describes the central dogma of biology? a) DNA is transcribed into RNA. RNA is translated into an amino acid sequence. b) Translation is the process of synthesizing RNA from DNA. Transcription is the process of synthesizing an amino acid sequence from RNA. c) Transcription is the process of synthesizing DNA from RNA. Translation is the process of synthesizing an amino sequence from DNA. d) DNA is transcribed to an amino acid sequence. RNA is translated to an...
Prokaryotic polypeptides that end in the amino acid sequence ANDENYALAA will be destroyed. Where does the...
Prokaryotic polypeptides that end in the amino acid sequence ANDENYALAA will be destroyed. Where does the information for this sequence originate? Group of answer choices It is encoded within the gene that codes for that polypeptide. It is attached by the Ski7 protein when it recognizes that the protein is misfolding. It is added by a suppressor tRNA. It is encoded by the tmRNA molecule.
Using this sequence: 5’ AUG GAG AGC CUU GUC CCU 3’ find: a) The translation product,...
Using this sequence: 5’ AUG GAG AGC CUU GUC CCU 3’ find: a) The translation product, indicating the N terminus and the C terminus, and using the one-letter code for amino acids b) The complementary non-coding RNA sequence that will serve as a template to the synthesis of other viral genomes, indicating the 5’ and 3’ ends
The transcription of a gene involves copying DNA nucleotides from DNA into a sequence of RNA...
The transcription of a gene involves copying DNA nucleotides from DNA into a sequence of RNA nucleotides. Many regulatory factors can help facilitate the transcription processes. One region that affects transcription is the terminator region, which is located on mRNA, downstream of the coding segment on DNA, in the 5' end of the gene on DNA, downstream of the coding segment on mRNA at the 5' end on DNA, within the coding region
Here’s an uncompleted table of a segment of the transcribed region of a gene in a...
Here’s an uncompleted table of a segment of the transcribed region of a gene in a prokaryote. Fill in the empty slots of this table with the appropriate nucleotide/amino acid based on the information you have here. (This requires that you use your awesome knowledge from previous weeks in this unit as well, but you can do it! I know this is challenging, but it’s not impossible. You have enough information here to crack this thing wide open.) DNA double...
Gly – Ser – Cys – Glu – Asp – Asn – Cys – Arg |__________________|...
Gly – Ser – Cys – Glu – Asp – Asn – Cys – Arg |__________________| S S 1. Write the peptide sequence shown above using single letters and the full names of the amino acids. 2. Which amino acid is at N- terminus and which is at the C- terminus of the peptide? 3. What is the charge on the peptide at pH 4.5? 4. Name the peptide (using the amino acids in the sequence)
1.     The primary sequence of the peptide listed below. H2N - Asp-Thr-Phe-Lys-COOH H2N – D -T...
1.     The primary sequence of the peptide listed below. H2N - Asp-Thr-Phe-Lys-COOH H2N – D -T – F – K – COOH Use the one letter amino acid code and identify from N-terminus to C-terminus. a.     Determine the pI of the peptide. (Round to 2 decimal points) b.     Would mutating residue #3 to Ala change the pI of the peptide? Explain. c.      Which type of noncovalent interaction would the indicated residue side chain make at the given pH? (H-bond, Hydrophobic...
Assessment sequence 1 CTGTCCATTTCATCAAGTCCTGAAATATCGAAATGGATTTAGAGAAAAATTACCCGACTCCTCGGACCAT CAGGACAGGACATGGAGGAGTGAATCAGCTTGGGGGGGTTTTTGTGAATGGACGGCCACTCCCAGATGTA GTCCGCCAAAGGATAGTGGAACTTGCCCATCAAGGTGTCAGGCCCTGCGACATCTCCAGGCAGCTTCGGG TCAGCCATGGTTGTGT
Assessment sequence 1 CTGTCCATTTCATCAAGTCCTGAAATATCGAAATGGATTTAGAGAAAAATTACCCGACTCCTCGGACCAT CAGGACAGGACATGGAGGAGTGAATCAGCTTGGGGGGGTTTTTGTGAATGGACGGCCACTCCCAGATGTA GTCCGCCAAAGGATAGTGGAACTTGCCCATCAAGGTGTCAGGCCCTGCGACATCTCCAGGCAGCTTCGGG TCAGCCATGGTTGTGTCAGCAAAATTCTTGGCAGGTATTATGAGACAGGAAGCATCAAGCCGGGGGTGAT TGGAGGATCCAAACCAAAGGTTGCCACTCCCAAAGTGGTGGAAAAAATCGCTGAGTACAAACGCCAAAAC CCTACCATGTTTGCCTGGGAGATCAGGGACCGGCTGTTGGCAGAGCGAGTCTGTGACAATGACACTGTGC CCAGCGTCAGCTCCATCAACAGGATCATTCGGACAAAAGTACAGCAGCCCCCCAATCAGCCGGTCCCAGC TTCCAGTCACAGCATAGTGTCTACAGGCTCCGTGACGCAGGTGTCATCGGTGAGCACCGACTCCGCGGGC TCCTCATACTCCATCAGTGGCATCCTGGGCATCACGTCCCCCAGTGCCGACACCAACAAACGCAAGAGGG ATGAAGGTATTCAGGAGTCTCCAGTGCCGAATGGCCACTCACTTCCGGGCCGGGACTTCCTCCGGAAGCA GATGCGGGGAGACCTGTTCACACAGCAGCAGCTGGAGGTGCTGGACCGCGTGTTTGAGAGACAGCACTAC TCTGACATCTTCACCACCACGGAACCCATCAAGCCAGAACAGACCACAGAGTATTCAGCCATGGCTTCAC TGGCTGGAGGCCTGGATGACATGAAAGCCAACTTGACGAGCCCCACCCCCGCTGACATCGGGAGCAGCGT TCCAGGCCCACAGTCCTACCCTATTGTCACAGGCCGAGACTTGGCGAGCACAACCCTCCCGGGGTACCCT CCACACGTCCCCCCCGCTGGACAGGGCAGCTACTCTGCACCGACGCTGACAGGGATGGTGCCTGGGAGTG AATTTTCTGGAAGTCCCTACAGCCACCCTCAGTATTCTTCCTACAATGATTCTTGGAGGTTCCCCAACCC AGGGCTGCTTGGCTCCCCATACTATTACAGCCCTGCAGCCCGAGGAGCGGCCCCACCGGCCGCAGCCACT GCGTACGACCGCCACTGA A) For nucleotide sequence, what is the protein (coded for by the gene for a nucleic acid sequence) and in what biological process is it involved? B) What is the scientific name of the organism C) How many nucleotides in the coding sequence D) How many amino acid translated
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA template strand Use the information above to answer the following questions. Write the sequences of the two double-stranded daughter DNAs which will be replicated from the sequence above. Indicate which sequences are directly from the parent. Show accurate direction of each sequence. 0.5 points Write the sequence of the mRNA strand that will be transcribed from the above DNA sequence. Show accurate direction of...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT