Question

A short piece of dna it's read from 5' to 3' on the template. TACGGCTATCGA what...

A short piece of dna it's read from 5' to 3' on the template. TACGGCTATCGA

what is the order of the non template strand.

the mRNA transcription of the short piece

what is the sequence of the aminoacid

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

The given template strand is --

5' - T A C G G C T A T C G A - 3'

The non-template or coding strand will be complementary to template strand, that will be written as --

3' - A T G C C G A T A G C T - 5'

In mRNA transcript, the base pair thymine will be replaced with uracil , which is formed in direction 3' to 5' complementary to template strand. It will be written as -----

3' - A U G C C G A U A G C U - 5'

The Amino acid is formed by a codon is, three base pair together code for one single amino acid. It will be formed by mRNA transcript. AUG is the start codon which code for methionine. CCG code for proline, AUA code for isoluiceine and GCU code for amino acid Alanine.

The following amino acids will be coded in following sequence, --

methionine - proline - Isoluiceine - Alanine

written as ---

3' - Met - pro - Ilo - Ala - 5'

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence...
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence of bases that in the complimentary strand of DNA? 2.) What is the mRNA that would be transcribed from this DNA?
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the...
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the mRNA molecule? The following sequence is located in the middle of an mRNA molecule past the first start codon, so that it is written in the correct reading frame (the first three nucleotides are the first codon, etc.) 5’ – UGC CUG ACA UGC AUC ACG UGG G – 3’. Translate this into a polypeptide (write the amino acid sequence), starting at the beginning...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA template strand Use the information above to answer the following questions. Write the sequences of the two double-stranded daughter DNAs which will be replicated from the sequence above. Indicate which sequences are directly from the parent. Show accurate direction of each sequence. 0.5 points Write the sequence of the mRNA strand that will be transcribed from the above DNA sequence. Show accurate direction of...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA template strand Use the information above to answer the following questions. Write the sequences of the two double-stranded daughter DNAs which will be replicated from the sequence above. Indicate which sequences are directly from the parent. Show accurate direction of each sequence. 0.5 points Write the sequence of the mRNA strand that will be transcribed from the above DNA sequence. Show accurate direction of...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA template strand Use the information above to answer the following questions. Write the sequences of the two double-stranded daughter DNAs which will be replicated from the sequence above. Indicate which sequences are directly from the parent. Show accurate direction of each sequence. 0.5 points Write the sequence of the mRNA strand that will be transcribed from the above DNA sequence. Show accurate direction of...
What type of mutation is shown? :Wildtype sequence template DNA strand 3’ TACAGTGGGTTC 5’    coding...
What type of mutation is shown? :Wildtype sequence template DNA strand 3’ TACAGTGGGTTC 5’    coding DNA strand 5’ ATGTCACCCAAG 3’    Mutant Sequence: template DNA strand 3’ TACAATGGGTTC 5’ coding DNA strand 5’ ATGTTACCCAAG 3’ a.) a missense mutation b.) a frameshift mutation c.) an exonic mutation d.) a silent mutation e.) a nonsense mutation
10. Given the following DNA sequence as the template strand: TTACGATGCCCA Finish the complementary DNA strand....
10. Given the following DNA sequence as the template strand: TTACGATGCCCA Finish the complementary DNA strand. AAT _ _ _ _ _ _ _ _ _ Finish the corresponding mRNA (use template strand) AAU _ _ _ _ _ _ _ _ _ Finish the corresponding protein sequence from the mRNA. (Use the table on mRNA codons to identify the protein sequence. For example, the mRNA codon AAU codes for the amino acid, asparagine, Asn. Asn-____-____-____ What would be the...
Use the information above to answer the following questions. 5’…TAC ACC GAT GGA TAA GTC…3’ DNA...
Use the information above to answer the following questions. 5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA template strand ONLY answer E and F please!! The rest is for reference!! A. Write the sequences of the two double-stranded daughter DNAs which will be replicated from the sequence above. Indicate which sequences are directly from the parent. Show accurate direction of each sequence. 0.5 points B. Write the sequence of the mRNA strand...
*A DNA template sequence is 3’ ATG 5’. The complimentary mRNA codon sequence is: A 5’...
*A DNA template sequence is 3’ ATG 5’. The complimentary mRNA codon sequence is: A 5’ TAC 3’      B 5’ UAC 3’      C 3’ TAC 5’      D 3’ UAC 5’
12. You have a short piece of DNA. One strand has the following sequence: 5’ AGCTACTCCTAA...
12. You have a short piece of DNA. One strand has the following sequence: 5’ AGCTACTCCTAA 3’. a. Please write down sequence of the other strand, starting with the 5’ end. (0.2 pt) b. If these two strand wind together as a B form DNA, how long do you expect this DNA to be? (0.2 pt) c. How many hydrogen bonds are there to stabilize the structure of this DNA? (0.2 pt) d. Besides hydrogen bonds, what other forces stabilize...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT