Question

Restriction digest A:

ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC

Restriction digest B:

ATTGAATTCCGGTTAGCTTTACAATTCCGCCATATGCGCAATTGGAATTCC

1. Now compare the same region of DNA from another individual (digest B). Where would EcoRI cut? How many fragments are formed?

Restriction digest B:

ATTGAATTCCGGTTAGCTTTACAATTCCGCCATATGCGCAATTGGAATTCC

a. Number of bases in each fragment:

Answer 1

Ans: The nucleic acid recognition sequence where the EcoR1 enzyme cuts is G/AATTC, which has a palindromic, complementary sequence of CTTAA/G.

But here we have only ss DNA fragment so the EcoR1 will cut after G in the sequence of GAATTC.

Now the sequence is:

5'-ATTG/AATTCCGGTTAGCTTTACAATTCCGCCATATGCGCAATTGG/AATTCC-3' and the bolded sequence represent the recognition sequence and / represents where the EcoR1 will cut.

So after the digestion by EcoR1 the fragments produced are: ATTG, AATTCCGGTTAGCTTTACAATTCCGCCATATGCGCAATTGG and AATTCC. So total 3 fragments will be formed.

Fragment 1 has 4 bases, fragment 2 has 41 bases and fragment 3 has 6 bases.