Question

1. Define supercoiling of DNA. Which type would promote strand separation? 2. What type of DNA...

1. Define supercoiling of DNA. Which type would promote strand separation?

2. What type of DNA supercoiling contributes to compacting chromosomes within cells?

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

1.Ans-

             The additional coils of DNA due to twisting force is called DNA supercoiling. Overtwisting and undertwisting cause positive and negative supercoiling respectively. It plays an important role in various biological processes such as compacting DNA and by regulating access to the genetic code.

          The negative supercoiling would promote strand separation that required for transcription and replication processes.

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
DNA Replication 1. Define DNA replication. 2. What is the role of base pairing in DNA...
DNA Replication 1. Define DNA replication. 2. What is the role of base pairing in DNA replication? Would this process of replication be possible without base pairing? 3. Describe the process of semi-conservative DNA replication. 4. Describe the experiment that led to the discovery that DNA was replicated through a semi-conservative process. 5. Define replication origins. 6. Why is the specific sequence of the replication origin relevant to DNA replication? 7. Describe the process of DNA replication, including the enzymes...
What type of mutation is shown? :Wildtype sequence template DNA strand 3’ TACAGTGGGTTC 5’    coding...
What type of mutation is shown? :Wildtype sequence template DNA strand 3’ TACAGTGGGTTC 5’    coding DNA strand 5’ ATGTCACCCAAG 3’    Mutant Sequence: template DNA strand 3’ TACAATGGGTTC 5’ coding DNA strand 5’ ATGTTACCCAAG 3’ a.) a missense mutation b.) a frameshift mutation c.) an exonic mutation d.) a silent mutation e.) a nonsense mutation
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence...
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence of bases that in the complimentary strand of DNA? 2.) What is the mRNA that would be transcribed from this DNA?
1. chemosinosis occurs in? 2. which enzyme physically copies a DNA strand in DNA replication? 3.Exothermic...
1. chemosinosis occurs in? 2. which enzyme physically copies a DNA strand in DNA replication? 3.Exothermic reactions require what? 4. when an enzyme runs a chemical reaction what happens to the enzyme at the end of the reaction? 5. what are the factors that affect an enzyme 3 dimensional structure? 6. when the codon read UAA what happens?
The DNA strand must be tightly organized and packaged to fit inside a cell. What type...
The DNA strand must be tightly organized and packaged to fit inside a cell. What type of biomolecule combines with DNA to accomplish this? A. histone proteins B. ribosomal RNA C. polysaccharides D. phospholipids E. high density lipoproteins
Molecular Biology and Biochemistry A DNA strand which is used as the template for transcription is...
Molecular Biology and Biochemistry A DNA strand which is used as the template for transcription is known as the ________. leading strand sense strand antisense strand lagging strand coding strand Sickle cell disease results from a point mutation of the __________. α-globin of hydrophilic amino acid for a hydrophobic amino acid β-globin of histidine for glycine β-globin of valine for glutamate γ-globin of proline for tyrosine γ-globin of glutamate for guanine Which of the following molecules has RNA-dependent DNA polymerase...
QUESTION 1 * Compared to the leading strand, the lagging strand requires ________ primers.?? A. more...
QUESTION 1 * Compared to the leading strand, the lagging strand requires ________ primers.?? A. more B. the same number of C. less QUESTION 2 * Which enzyme synthesizes the majority of the DNA polymer for both the leading and lagging strands??? A. DNA polymerase I B. primase C. DNA polymerase III D. helicase QUESTION 3 * For each origin of replication, how many DNA polymerase III enzymes are needed??? A. 1 B. 8 C. 4 D. 2 QUESTION 4...
Exposure to a mutagen caused the following DNA change within exon #1 of a gene. What...
Exposure to a mutagen caused the following DNA change within exon #1 of a gene. What type of mutation is this? Wildtype sequence template DNA strand 3’ TACAGTGGGTTC 5’    coding DNA strand 5’ ATGTCACCCAAG 3’    Mutant Sequence template DNA strand 3’ TACAATGGGTTC 5’ coding DNA strand 5’ ATGTTACCCAAG 3 a missense mutation a silent mutation an exonic mutation a frameshift mutation a nonsense mutation
1. What determines the sequence of nucleotides on the newly synthesized strands during DNA replication? a....
1. What determines the sequence of nucleotides on the newly synthesized strands during DNA replication? a. the nucleotide sequence of the template strand b. the way that the parental DNA strands are untangled by topoisomerase. c. the genetic code, as specified by the RNA reading frame d. the nucleotide sequence of the coding strand 2. A difference between meiosis and mitosis is that_________. a. DNA replication occurs twice in meiosis but only once in mitosis b. sister chromosomes are always...
3. Synthesis of telomeres requires the enzyme ------------, which is a type of ---------------. a. telomerase;...
3. Synthesis of telomeres requires the enzyme ------------, which is a type of ---------------. a. telomerase; helicase b. DNA polymerase; ligase c. telomerase; reverse transcriptase d. ribonuclease; RNA-specific nuclease ____ 4. An Okazaki fragment is a a. piece of DNA that is synthesized in the 3’5’ direction b. small segment of DNA that is an intermediate in the synthesis of the lagging strand c. fragment of DNA resulting from an endonuclease reaction d. fragment of RNA that is a subunit...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT