Question

What could be the impact of a mutation in a region of DNA that is recognized...

What could be the impact of a mutation in a region of DNA that is recognized and bound by a transcription factor (e.g. sigma factor, the lac repressor, or CAP)?

No change to binding at that site

Increased protein binding at that site

Reduced protein binding at that site

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

Above mentioned all results are possible. This depends on the type of mutation occuring in DNA sequence. Some mutation may increase the affinity of TF for the DNA sequence and some may decrease the binding affinity . If a neutral mutation or silent mutation occurs, then there will be no change to binding site

Transcription factor have specific domain which bind to the target DNA sequence by recognising these sequence. These domains of transcription factors are evolutionary conserved and if any mutation occurs in the cis regulatory element which is recognised by these domain, then this may affect the binding of the transcription factor to the DNA sequence .

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
The famous -10 and -35 DNA sigma factor binding motifs function as? A. DNA sequence landmarks...
The famous -10 and -35 DNA sigma factor binding motifs function as? A. DNA sequence landmarks that ensure proper sigma favor binding to promoter regions, and as a result bring along RNA polymerase to park at a position enabling transcription at position +1. B. the -10 motif binds inducers (e.g., Cap/cAMP) and -35 motif binds a repressor (e.g., LacI). C. DNA sequence landmarks that interact directly with RNA polymerase placing the transcription initiation at position +1. D. transcription repressors, preventing...
1. The lac operon responds to lactose and glucose. If wild-type E. coli cells are grown...
1. The lac operon responds to lactose and glucose. If wild-type E. coli cells are grown in media that contains both lactose and glucose, they will consume the glucose first because: (select all that apply) A.) the lac repressor remains bound to lacO, preventing the lac operon from being expressed at maximal levels B.) the permease (lacY) is not expressed in the presence of glucose, preventing lactose from entering the cell and being converted to allolactose, the inducer C.) the...
1.    The lac operon in E. coli comprises three structural genes, lac Z, lacY, and lacA....
1.    The lac operon in E. coli comprises three structural genes, lac Z, lacY, and lacA. It is regulated by both positive and negative mechanisms, involving binding of both a repressor protein and the catabolite activator protein (CAP). Transcription of the operon gives a polycistronic mRNA encoding the three enzymes. Under the following nutritional conditions, indicate whether or not the repressor and the CAP are bound by drawing them in on the appropriate regions of the operon. Indicate, as well,...
A transcription factor “T” is a critical regulator of the expression of the gene “G”. “T”...
A transcription factor “T” is a critical regulator of the expression of the gene “G”. “T” works as a dimer and normally resides in the cytoplasm until the small protein signal molecule “P” is bound to it. When “P” is bound to “T” the transcription factor is moved to the nucleus and can regulate the expression of the gene “G”. Explain what would be the expression of the gene “G” if: A) There is a mutation in “T” that removes...
What are the consequences of a mutation in the C3 protein that impairs the functioning of...
What are the consequences of a mutation in the C3 protein that impairs the functioning of C3a, but has no effect on C3b (select all that apply)? a. Reduced binding of Mannose Binding Lectin or Ficolin to the pathogen b. Impaired recruitment of macrophages to site of infection c. Impaired formation of Membrane Attack Complex d. Impaired binding of Complement Receptor 1 (CR1) to the pathogen e. Reduced levels of histamines and other inflammatory mediators at site of infection
A mutation has occurred in the DNA binding sequence for p53. The binding site is Pu-Pu-Pu-C-A/t-T/a-G...
A mutation has occurred in the DNA binding sequence for p53. The binding site is Pu-Pu-Pu-C-A/t-T/a-G Py-Py-Py; and is converted to Pu-Pu-Pu-T-A/t-T-A/t-T/a-G Py-Py-Pu in the promoter of the Mdm2 gene. What base would be methylated? What would be the effect of such a mutation on methylation ? What could be the effect of such a mutation on p53 binding? And, why? How would the expression of Mdm2 be affected ?
ANSWER KEY Recombinant DNA Anticodon Mutation Uracil Codon Replication tRNA Thymine Antiparallel Translation Transcription Polymerase Chain...
ANSWER KEY Recombinant DNA Anticodon Mutation Uracil Codon Replication tRNA Thymine Antiparallel Translation Transcription Polymerase Chain Reaction Match the correct answer with the corresponding statement. A base found in RNA but not DNA A base found in DNA but not RNA The opposite directions run by two strands of DNA double helix Protein synthesis When mRNA is synthesized from DNA When a strand of DNA makes a new copy prior to cell division The RNA that carries amino acids to...
Remember: Crx is a key retinal transcription factor. Crx binds regulatory elements called CBRs (Crx-binding regions)....
Remember: Crx is a key retinal transcription factor. Crx binds regulatory elements called CBRs (Crx-binding regions). You use the DNA sequences from the patients to create plasmids for a luciferase assay. In a luciferase assay you add your promoter and any regulatory regions of interest to a vector containing the gene for luciferase. You then transform bacteria with the vector (you make bacteria take up the vector). The transcription of luciferase is controlled by the promoter/regulatory region you added to...
Retinitis pigmentosa is a genetic disease that causes the breakdown and loss of retinal cells. Retinitis...
Retinitis pigmentosa is a genetic disease that causes the breakdown and loss of retinal cells. Retinitis pigmentosa often starts with decreased night vision and will progress to blindness as retinal cells die. Several genes have been linked to Retinitis pigmentosa, one of which is GADD. Mice lacking GADD (these mice were experimentally created so that the GADD region of the genome was deleted) have increased expression of non-retinal genes in retinal cells. In other words, in these mutant mice, genes...
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation...
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation occurred. (insertion, deletion, or substitution) Identify what type of protein change resulted. (frameshift, missense, nonsense, or silent) Normal Sequence 3’ TACCTTCACCGCAGGGTAGCTTTTATTTAA 5’ Mutated sequence 3’ TACCTTCACCGCAGGTAGCTTTTATTTAA 5’
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT