Question

A mutation has occurred in the DNA binding sequence for p53. The binding site is Pu-Pu-Pu-C-A/t-T/a-G...

A mutation has occurred in the DNA binding sequence for p53. The binding site is Pu-Pu-Pu-C-A/t-T/a-G Py-Py-Py; and is converted to Pu-Pu-Pu-T-A/t-T-A/t-T/a-G Py-Py-Pu in the promoter of the Mdm2 gene. What base would be methylated? What would be the effect of such a mutation on methylation ? What could be the effect of such a mutation on p53 binding? And, why? How would the expression of Mdm2 be affected ?
Engineering   Chemical-Engineering   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
A transcription factor “T” is a critical regulator of the expression of the gene “G”. “T”...
A transcription factor “T” is a critical regulator of the expression of the gene “G”. “T” works as a dimer and normally resides in the cytoplasm until the small protein signal molecule “P” is bound to it. When “P” is bound to “T” the transcription factor is moved to the nucleus and can regulate the expression of the gene “G”. Explain what would be the expression of the gene “G” if: A) There is a mutation in “T” that removes...
11. Assuming that there is a mutation such that the new sequence would be: DNA: TTAGCTAGATAAAACCGGCCCACGTTCTTACTTTT...
11. Assuming that there is a mutation such that the new sequence would be: DNA: TTAGCTAGATAAAACCGGCCCACGTTCTTACTTTT What would be the effect on the sequences of the mRNA & tRNA & the final protein’s sequence? mRNA: transcribe mRNA using the following from the DNA string: T=A, A=U, G & C pair tRNA: transcribe tRNA using the following from the mRNA string: A & U pair, G & C pair Protein: using the Condon chart and the mRNA strand. What I do...
5’ – A T G G G A G T A A C A G A...
5’ – A T G G G A G T A A C A G A A T T T G G A T C A T T A T A A – 3’ Assume this is occurring in a bacterium, note the coding strand of DNA above. Now the 13th nucleotide in the DNA coding strand has mutated. The 13th nucleotide is substituted for a thymine. Answer the following questions. - Would there be any change in the amino...
Below is the initial part of the gene sequence for  Glut1 as reported in Flybase. It includes...
Below is the initial part of the gene sequence for  Glut1 as reported in Flybase. It includes the 3' untranslated sequence and the first part of the translated sequence. The promoter for this gene is TATAT. Transcription begins with the third base after the promoter. For each answer portion, in your response, write each one starting on a new line and please write A, B, C, etc. as you go. A)   Transcribe and B). translate this sequence into its final peptide...
16. You digested a linear DNA fragment with a RE and the fragment has three recognition...
16. You digested a linear DNA fragment with a RE and the fragment has three recognition sites for the RE. How many fragments of DNA will be produced? A. three                B. four C. five D. six                     17. The RE HhaI cuts the recognition site 5’GCGC3’. The probability of having a cutting site for this enzyme is about one in every __________bp of genomic DNA. A. 100 B. 250                C....
1.A technique used to identify RNA after gel electrophoresis and which employs ssDNA in the detection...
1.A technique used to identify RNA after gel electrophoresis and which employs ssDNA in the detection process is the _____ blot. Select one: a. Northern b. Western c. Northeastern d. Southern e. Southwestern 2. DNA sequencing by controlled termination of replication is called the _____ method. Select one: a. Sanger b. E. coli c. Restriction enzymes d. DNA Microarray e. Ligase f. Polymerase Chain Reaction g. Footprint h. Reverse Trancriptase i. Vector j. Expression k. Fluorescent l. cDNA 3. How...
The Patient: A 10-year old black male child named Michael Jones was admitted to the hospital...
The Patient: A 10-year old black male child named Michael Jones was admitted to the hospital because he was experiencing severe chest pain. He had been hospitalized on several previous occasions for vaso-occlusive episodes that caused him to experience severe pain that could not be managed with non-prescription drugs such as ibuprofen. He was slightly jaundiced, short of breath and easily tired, and feverish. A chest x-ray was taken and was abnormal. An arterial blood sample showed a PO2 value...
1.What is the major component of blood plasma? a Nutrients b Ions c Water d Gases...
1.What is the major component of blood plasma? a Nutrients b Ions c Water d Gases 2. How many layers of phospholipids does the cell membrane contain? a 1 b 2 c 4 d 3 3. Which substance stores polysaccharides in plants? a Sucrose b Glycogen c Glucose d Cellulose 4. An important concept in DNA and RNA structure is complementary base pairing. Which tow bases are incorrectly paired? a T-U b A-T c C-G d A-U 5. If the...
What tools could AA leaders have used to increase their awareness of internal and external issues?...
What tools could AA leaders have used to increase their awareness of internal and external issues? ???ALASKA AIRLINES: NAVIGATING CHANGE In the autumn of 2007, Alaska Airlines executives adjourned at the end of a long and stressful day in the midst of a multi-day strategic planning session. Most headed outside to relax, unwind and enjoy a bonfire on the shore of Semiahmoo Spit, outside the meeting venue in Blaine, a seaport town in northwest Washington state. Meanwhile, several members of...
READ THE CASE STUDY AND ANSWER THE FOLLOWING QUESTIONS 2nd CASE: An Unexplained Death A 65-year-old...
READ THE CASE STUDY AND ANSWER THE FOLLOWING QUESTIONS 2nd CASE: An Unexplained Death A 65-year-old man of Scandinavian descent was rushed to the Emergency Room of your local hospital after a family member discovered him unconscious in his home. The woman who dialed “911” told the dispatcher that the man, her brother, was the local librarian of the past 10 years and had no spouse or children. She reported that they had spoken the day before, and he had...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT