Question

Explain the relationship between sequence, structure, and function in terms of amino acid sequence.


Explain the relationship between sequence, structure, and function in terms of amino acid sequence.

Homework Answers

Answer #1

Sequence of a protein largely dictates the structure. Hydrophobic residues are buried in the interior of the protein while hydrophilic residues are exposed. The residues required for binding the substrate should have their charged groups exposed and accessible. Such phenomena impose restrictions on the protein fold, thus defining its structure. Function is supported by the structure and sequence. For example, a dehydrogenase should have the Rossmann fold in the structure. Function can be brought about only by the presence of the requisite residues placed correctly in the structure.

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
Biochemists who study protein structure and function often introduce mutations (changes) to a protein's amino acid...
Biochemists who study protein structure and function often introduce mutations (changes) to a protein's amino acid sequence. One common change is an amino acid substitution that can creates a modified protein that can mimic (function similar to) a phosphorylated protein. Using what you know about different amino acids, which amino acid(s) would be a good choice for this change to a phosphorylated-like state? Briefly explain why.
Explain why is it impossible to take the amino acid sequence and determine the exact DNA...
Explain why is it impossible to take the amino acid sequence and determine the exact DNA code? (Detailed)
First, translate the following mRNA sequence into an amino acid sequence mRNA sequence : A U...
First, translate the following mRNA sequence into an amino acid sequence mRNA sequence : A U G U C C U U U U A A Amino acid sequence : ______ ______ ______ ______ Second, create a single base substitution in the second codon of the above mRNA sequence that: a) changes the resulting amino acid into a Cys ___________ b) causes a silent mutation ___________
Create a sequence of a 21-amino acid peptide that you think would self-assemble into a coiled-...
Create a sequence of a 21-amino acid peptide that you think would self-assemble into a coiled- coil structure. Design one. Underline the hydrophobic and polar amino acids in the sequence.
Why does factor ix have the same catalytic triad in the amino acid structure as chymotrypsin...
Why does factor ix have the same catalytic triad in the amino acid structure as chymotrypsin but it is located at a different place in the amino acid sequence?
Determining Amino Acid Sequence • A nonapeptide was determined to have the following amino acid composition:...
Determining Amino Acid Sequence • A nonapeptide was determined to have the following amino acid composition: – (Lys)2 Gly Leu Ala Met Phe Thr Glu • When treated with trypsin, a tripeptide, a pentapeptide and free threonine were obtained. The tripeptides N-term was Leu, and the pentapeptides N-term was Glu 40 Determining Amino Acid Sequence • When treated with chymotrypsin, a heptapeptide and a dipeptide were obtained. The heptapeptides N-term was Leu, and the dipeptides N-term was Lys. • When...
What is the correct amino acid sequence for the following DNA nucleotide sequence: GTAACAGAAGTACTTCCAGTACTA
What is the correct amino acid sequence for the following DNA nucleotide sequence: GTAACAGAAGTACTTCCAGTACTA
Predict the effects of the following amino acid substitutions (mutations) on a protein’s structure and function:...
Predict the effects of the following amino acid substitutions (mutations) on a protein’s structure and function: a. Changing Leu to Phe b. Changing Lys to Glu c. Changing Val to Thr d. Changing Gly to Ala e. Changing Met to Pro
Draw the structure of the amino acid glycine.
Draw the structure of the amino acid glycine.
If you know the amino acid sequence in a cell,how do you determine the DNA ?...
If you know the amino acid sequence in a cell,how do you determine the DNA ? Please Explain