Question

What is the correct amino acid sequence for the following DNA nucleotide sequence: GTAACAGAAGTACTTCCAGTACTA

Answer 1

Answer.

As the amino acid sequences need to be tell in this question i am providing you in step with writing on paper and i will provide you some terms defined by typing.

DNA is the genetic material of the body which is a double helix structure made up of the nucleotide which binds and forms a structure.

These nucleotide are bind form a strand of DNA from which the RNA is formed by the process of transcription and then protein chain is formed by the process of translation in which every three nucleotide code for a specific amino acid that binds with the peptide bond and forms a protein chain.

Here are the data.

This is the first page.

This is the second page shows the primary protein synthesis which is coded by RNA sequences and the codon are

amino group---Histidine --- cysteine --- leucine --- histidine --- glutamine ---- glycine ---- histidine --- aspartate----carboxylic group

this is the chain of the codons binded with peptide bond and protein is formed.

In this when rna is formed from the DNA then the adenine are converted into uracil as thymine is not present in the RNA. chain is the expectation.

Now a amino acid codon chart for recognitions of the codon.

This is the genetic code table.

I hope this meets your requirement you can comment me if any thing you want more.

Good wishes.