Question

Explain why is it impossible to take the amino acid sequence and determine the exact DNA...

Explain why is it impossible to take the amino acid sequence and determine the exact DNA code? (Detailed)

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
If you know the amino acid sequence in a cell,how do you determine the DNA ?...
If you know the amino acid sequence in a cell,how do you determine the DNA ? Please Explain
What is the correct amino acid sequence for the following DNA nucleotide sequence: GTAACAGAAGTACTTCCAGTACTA
What is the correct amino acid sequence for the following DNA nucleotide sequence: GTAACAGAAGTACTTCCAGTACTA
Given the DNA template strand 3' GTCGAACGT 5', write the amino acid sequence in the N-terminal...
Given the DNA template strand 3' GTCGAACGT 5', write the amino acid sequence in the N-terminal to the C-terminal direction. Use the three-letter amino acid abbreviations.
A. Using the genetic code table, answer the following questions: Determine the sequence of amino acids...
A. Using the genetic code table, answer the following questions: Determine the sequence of amino acids from an mRNA sequence CCGUGU Determine the sequence of amino acids from a DNA template strand AATGTT List the start codon List the stop codons
Construct a drawing of the process by which a DNA code is converted into an amino...
Construct a drawing of the process by which a DNA code is converted into an amino acid sequence
Explain the relationship between sequence, structure, and function in terms of amino acid sequence.
Explain the relationship between sequence, structure, and function in terms of amino acid sequence.
Why are DNA sequences (or amino acid sequences encoded in genes ) such powerful characters for...
Why are DNA sequences (or amino acid sequences encoded in genes ) such powerful characters for use in cladistics?                                      A.)because each nucleotide in the sequence is a separate character, yielding millions of characters.                                                                        B.)DNA is the only rigorous way in which to assess evolutionary relatedness.                                C.)It yields inherently more robust characters.
DNA sequence. 5’-CTACACTTTATCGTTAATCTGCCAGAAGCACCCCTCCAGGTGTCTACTGTATGGTGTCGCCAT-3’ “Transcribe” and form an RNA transcript based on the DNA sequence. Illustrate the...
DNA sequence. 5’-CTACACTTTATCGTTAATCTGCCAGAAGCACCCCTCCAGGTGTCTACTGTATGGTGTCGCCAT-3’ “Transcribe” and form an RNA transcript based on the DNA sequence. Illustrate the amino acid sequence of the resulting polypeptide using the genetic code. *Please follow proper directionality of both the RNA strand and the polypeptide. Indicate clearly and label correctly the ends of the molecules mentioned. What is/are the characteristic feature/s of the resulting polypeptide based on the viral DNA sequence given?
10. Given the following DNA sequence as the template strand: TTACGATGCCCA Finish the complementary DNA strand....
10. Given the following DNA sequence as the template strand: TTACGATGCCCA Finish the complementary DNA strand. AAT _ _ _ _ _ _ _ _ _ Finish the corresponding mRNA (use template strand) AAU _ _ _ _ _ _ _ _ _ Finish the corresponding protein sequence from the mRNA. (Use the table on mRNA codons to identify the protein sequence. For example, the mRNA codon AAU codes for the amino acid, asparagine, Asn. Asn-____-____-____ What would be the...
First, translate the following mRNA sequence into an amino acid sequence mRNA sequence : A U...
First, translate the following mRNA sequence into an amino acid sequence mRNA sequence : A U G U C C U U U U A A Amino acid sequence : ______ ______ ______ ______ Second, create a single base substitution in the second codon of the above mRNA sequence that: a) changes the resulting amino acid into a Cys ___________ b) causes a silent mutation ___________
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT