Question

Explain the importance of sequence-specific DNA and RNA-binding proteins in the regulation of gene expression, with...

Explain the importance of sequence-specific DNA and RNA-binding proteins in the regulation of gene expression, with reference to a member of each class of regulatory protein.

Homework Answers

Answer #1

Answer- it is very important that the specificity is the most urgent condition for the binding of protein in gene expression otherwise the gene will be expressed but the product will be something else that will destroy the pathway for which the protein was coded by DNA or RNA.

The regulatory protein allow the regulation by promoting or inhibiting the expression. The binding of promoter protein will allow gene expression while the binding of inhibitor will inhibit the expression.

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
Genetics: What is the importance of controlling gene expression in the molecular pathway from DNA to...
Genetics: What is the importance of controlling gene expression in the molecular pathway from DNA to RNA to Protein in Eukaryotic cells?
MicroRNAs (miRNAs) __________. MicroRNAs (miRNAs) __________. are artificial RNAs used to interfere with gene expression can...
MicroRNAs (miRNAs) __________. MicroRNAs (miRNAs) __________. are artificial RNAs used to interfere with gene expression can regulate gene expression at the genomic, posttranscriptional, and translational levels are examples of eukaryotic riboswitches are produced by transcription of both strands of a DNA sequence Which of the following is NOT an example of genomic control of gene regulation? Which of the following is NOT an example of genomic control of gene regulation? DNA methylation alternative RNA splicing DNA rearrangement gene amplification Based...
The transcription of a gene involves copying DNA nucleotides from DNA into a sequence of RNA...
The transcription of a gene involves copying DNA nucleotides from DNA into a sequence of RNA nucleotides. Many regulatory factors can help facilitate the transcription processes. One region that affects transcription is the terminator region, which is located on mRNA, downstream of the coding segment on DNA, in the 5' end of the gene on DNA, downstream of the coding segment on mRNA at the 5' end on DNA, within the coding region
1. As the RNA polymerase is synthesizing new RNA, it uses one strand of the DNA...
1. As the RNA polymerase is synthesizing new RNA, it uses one strand of the DNA as a template and it adds a new nucleotide to which end of the growing RNA strand? As it moves along the DNA template, which direction is the polymerase moving? 2. In eukaryotes, the genomic DNA is packaged with proteins called histones. What is the term for the combination of DNA + histones? 3. In eukaryotes, when the initial RNA is transcribed, is it...
You are investigating the regulation of the eukaryotic fledermaus gene (fm). Analysis of many types of...
You are investigating the regulation of the eukaryotic fledermaus gene (fm). Analysis of many types of data have indicated that the gene products listed below are all involved in regulating the expression of fm. For each gene product, state the most likely mechanism by which it regulates expression of fm and whether it most likely inhibits the gene, activates the gene, or whether there is insufficient information to say. The gene sequence of this protein shows that it has a...
3. Explain the structure and regulation of a typical bacterial inducible operon. Include DNA elements, DNA-binding...
3. Explain the structure and regulation of a typical bacterial inducible operon. Include DNA elements, DNA-binding proteins and possible outcomes in the presence/absence of an inducer.
During transcription, the sequence of nucleotides in a gene in the DNA determines the sequence of...
During transcription, the sequence of nucleotides in a gene in the DNA determines the sequence of ________ in mRNA. Proteins are polymers of 20 different types of amino acids. During translation, the sequence of nucleotides in mRNA determines the sequence of _________ in the protein.
Which of the following statements about the regulation of gene expression in eukaryotes is correct? A....
Which of the following statements about the regulation of gene expression in eukaryotes is correct? A. Gene activity cannot be regulated by the packaging of DNA. B. Gene activity can be regulated by initiation of transcription. C. Gene activity cannot be regulated by processing of the RNA transcript. D. Gene activity cannot be regulated by elongation of the RNA transcript. E. Gene activity cannot be regulated by termination of the RNA transcript.
To determine whether regulation of gene expression by short RNAs was a naturally occurring phenomenon, researchers...
To determine whether regulation of gene expression by short RNAs was a naturally occurring phenomenon, researchers isolated RNA from a cell and fractionated them by size to obtain only short RNAs. The next step was to clone these molecules. Today the cloning step would not be required. Which of the techniques below is the best reason why? Because a microarray could tell if the fragments were encoded by the genome. Because a PCR reaction could tell if the fragments were...
Question 1: Explain what differential gene expression is. Question 2: Examine the following DNA template sequence...
Question 1: Explain what differential gene expression is. Question 2: Examine the following DNA template sequence from a eukaryotic gene, transcription starts with and includes the bold A, the bold sequence (CGTGTCCC) is an intron. 3' CTCCGATATATAAAGGGGTCAGTCTACCGCCTCACGTGTCCCTGCGGGTCACAATT5' Write out the mature mRNA sequence, include an explanation of each modification you made. (hint there are three modifications you have to make).