Question

Question 1: Explain what differential gene expression is. Question 2: Examine the following DNA template sequence...

Question 1: Explain what differential gene expression is.

Question 2: Examine the following DNA template sequence from a eukaryotic gene, transcription starts with and includes the bold A, the bold sequence (CGTGTCCC) is an intron.

3' CTCCGATATATAAAGGGGTCAGTCTACCGCCTCACGTGTCCCTGCGGGTCACAATT5'

Write out the mature mRNA sequence, include an explanation of each modification you made. (hint there are three modifications you have to make).

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

Answer 1) Differential gene expression is defined as the expression of combination of genes in a cell which leads to differentiate the cell. There is found differentiation of specific genes and represses the other genes which are not utilised at that time. This id done by the means of certain transcription factor, activator and silencer. It helps the cell to respond in a changing environment.

Answer 2)

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
A portion of a protein-coding gene is provided for this question. Given the non-template DNA sequence...
A portion of a protein-coding gene is provided for this question. Given the non-template DNA sequence of 5'-TACTATGCTGAGCATTATTGCTAAGTGATGGCTA-3': a. Write the complementary template DNA sequence in a 5' to 3' direction. b. Write the mRNA sequence that would be transcribed from this segment of DNA in a 5' to 3' direction. c. Starting from the first start codon, write the polypeptide sequence that would be translated from the mRNA sequence. d. Define the following terms in your own words: frameshift...
Below is the initial part of the gene sequence for  Glut1 as reported in Flybase. It includes...
Below is the initial part of the gene sequence for  Glut1 as reported in Flybase. It includes the 3' untranslated sequence and the first part of the translated sequence. The promoter for this gene is TATAT. Transcription begins with the third base after the promoter. For each answer portion, in your response, write each one starting on a new line and please write A, B, C, etc. as you go. A)   Transcribe and B). translate this sequence into its final peptide...
1)This stretch of DNA includes the beginning of the protein-coding region of a gene. The lower...
1)This stretch of DNA includes the beginning of the protein-coding region of a gene. The lower strand is the template strand. 5’...T A A T G A G T G T T G T T A G T ...3’ .    3’...A T T A C T C A C A A C A A T C A ...5’ ← template strand What is the corresponding mRNA that would be created from this portion of the gene? 2) This stretch of...
1.What are the building blocks of nucleic acids? 2.What are the 3 components of these building...
1.What are the building blocks of nucleic acids? 2.What are the 3 components of these building blocks ? 3.How is RNA different from DNA? Give three specific reasons. a._______________________________________________ b._______________________________________________ c._______________________________________________ 4.What are the three types of RNA found in a cell, what is the function of each and are these translated? RNA Function Translated? a. b. c. 5.What is a codon? a. Anticodon? Each of the following questions asks you to work out a sequence of nucleotide bases. When...
1. For the lac operon, explain briefly what would happen and why regarding expression of the...
1. For the lac operon, explain briefly what would happen and why regarding expression of the operon in each of the following scenarios. Be sure to include both positive and negative regulation in your explanation. a.) lactose is present, glucose is absent b.) lactose is absent, glucose is present c.) both lactose and glucose are present d.) lactose is present, glucose is absent, but there is a mutation to the sequence in the CAP site 2.) Consider the following RNA...
12. If the DNA repair mechanisms fail to correct a defect in nucleotide sequencing, a permanent...
12. If the DNA repair mechanisms fail to correct a defect in nucleotide sequencing, a permanent change known as a __________________ may result. 13. As the enzyme helicase opens and “unzips” the two strands of DNA by breaking the hydrogen bonds, a Y-shaped ________________________ forms. a. Lagging strand b. Leading strand c. Okazaki fragment d. Replication fork 14. One large difference between transcription and translation between prokaryotes and eukaryotes is that, in prokaryotes: a. Translation occurs simultaneously with transcription b....
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT