Question

which 10-bp primer can be used to amplify the following DNA sequence? 5'-GTCATTGCCTAGCCTAAGCTAAAGCTA-3' which of the...

which 10-bp primer can be used to amplify the following DNA sequence? 5'-GTCATTGCCTAGCCTAAGCTAAAGCTA-3'

which of the following amino acids yield TCA cycle intermediates when deaminated?

Aspartate and Alanine

Glutamate and Asparate

Alanine and Glutamate

Arginine and Aspartate

Glutamate and Arginine

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

1) we need two primers to amplify the sequence.

forward primer: forward primer binds to the other strand at the 3` end so forward primer has the same sequence as that of the given strand at the 5` end.

forward primer: 5`-GTCATTGCCTA-3`

Reverse primer binds to the 3` end of the given strand. so reverse primer is complementary to the 3` end of the given strand.

reverse primer: 5`-TAGCTTTAGC-3`

2) glutamate is deaminated to alpha-ketoglutarate and Aspartate is deaminated to oxaloacetate, Alanine is deaminated to pyruvate.

Oxaloacetate and alpha-ketoglutarate are intermediates of TCA cycle. so the answer is Glutamate and Aspartate.

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
Which of the following is an accurate statement regarding the relationship between primers and nucleic acid...
Which of the following is an accurate statement regarding the relationship between primers and nucleic acid synthesis? During DNA replication, primers are used to initiate DNA synthesis, and these primers are incorporated into the final daughter strand products. During DNA replication, leading strands are synthesized by DNA polymerase III without utilizing a primer. During DNA replication, every Okazaki fragment synthesized by DNA polymerase III is elongated from a separate RNA primer. Primase catalyzes the de novo polymerization of DNA. Thymine...
7. In which ONE of the following are amino groups from protein degradation secreted from the...
7. In which ONE of the following are amino groups from protein degradation secreted from the body? a. ammonium b. uric acid c. glutamine d. urea e. glutamate 8. If an amino acid is glucogenic this means which ONE of the following? a. can be used instead of glucose b. stimulates release of glucagon from the pancreas c. can be used to synthesise glucose d. can be synthesised from glucose e. is essential in the diet 9. Ammonium (NH4+) can...
Fragment of double-stranded DNA: 5' TGGCAGTCGATGCTGCTAGCTGGCCTTGAGTCGTGC 3' Which primer could amplify the whole fragment of the...
Fragment of double-stranded DNA: 5' TGGCAGTCGATGCTGCTAGCTGGCCTTGAGTCGTGC 3' Which primer could amplify the whole fragment of the following? a) 5’ GACTGCCA 3’ & 5’ GCACGACT 3’ b) 5’ GACTGCCA 3’ & 5’ AGTCGTGC 3’ c) 5’ TGGCAGTC 3’ & 5’ GCACGACT 3’ d) 5’ TGGCAGTC 3’ & 5’ AGTCGTGC 3’ e) 5’ TGGCAGTC 3’ & 5’ CGTGCTGA 3’
3) For the de novo synthesis of the amino acids: a) Which 10 amino acids are...
3) For the de novo synthesis of the amino acids: a) Which 10 amino acids are derived from the citric acid cycle intermediates -ketoglutarate and oxaloacetate? b) Which nine amino acids are derived from the glycolytic intermediates 3-phosphoglycerate, PEP and pyruvate? c) Which amino acid is derived by consequence of pentose phosphate pathway?
Shown below is DNA sequence on the coding strand for a structural gene. 5'-AGGACTAAATGACATGGACACTAACTAGTTGGAAGCTAACCC... -3' How...
Shown below is DNA sequence on the coding strand for a structural gene. 5'-AGGACTAAATGACATGGACACTAACTAGTTGGAAGCTAACCC... -3' How many amino acids does the polypeptide encoded by this sequence contain? A. 7 B. 8 C. 6 D. 12 E. 10
You use the Sanger sequencing protocol to sequence the following DNA fragment: 5’-TGCACGGGTCAGCT-(primer site)-3’ Draw a...
You use the Sanger sequencing protocol to sequence the following DNA fragment: 5’-TGCACGGGTCAGCT-(primer site)-3’ Draw a picture of the resulting sequencing gel, with products ending in each of the four dideoxynucleotides (ddATP, ddTTP, ddCTP, and ddGTP) in separate lanes of the gel. Be sure to label each lane as ddATP, ddTTP, ddCTP, or ddGTP.
A DNA template has the following sequence: 5’-GCTTACTGGCCCGGTTTATTGCCCATCGCC-3’ Infer a transcribed mRNA sequence first, identify the...
A DNA template has the following sequence: 5’-GCTTACTGGCCCGGTTTATTGCCCATCGCC-3’ Infer a transcribed mRNA sequence first, identify the start codon, and determine the complete amino acid sequence that would be translated. Be specific about the amino-terminus and carboxyl-terminus.
1)  Identify the polypeptide (Using the 3-letter abbreviations for amino acids) that would be produced as a...
1)  Identify the polypeptide (Using the 3-letter abbreviations for amino acids) that would be produced as a result of transcribing and translating the following DNA sequence. DNA: ...3' A C C A A G T C T 5'... 2)  The strand of DNA used above undergoes a mutation, such that the second C from the 3' end is changed to a T. What would change in the polypeptide? 3) List the different codons that can code for arginine.
The following template sequence of DNA was isolated from a bacterial cell. Identify the promoter region...
The following template sequence of DNA was isolated from a bacterial cell. Identify the promoter region (assume there is no operator) and transcribe the DNA to the right of the promoter. Once you’ve transcribed the DNA into mRNA, find the start codon and translate the sequence into the correct amino acids to create a polypeptide. 3’-AATATTTATTATATAACCCGGCATACGTTCGGACGTCCCATATAGACTCCATTCGACTT-5’
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the...
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the mRNA molecule? The following sequence is located in the middle of an mRNA molecule past the first start codon, so that it is written in the correct reading frame (the first three nucleotides are the first codon, etc.) 5’ – UGC CUG ACA UGC AUC ACG UGG G – 3’. Translate this into a polypeptide (write the amino acid sequence), starting at the beginning...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT