Question

A DNA template has the following sequence: 5’-GCTTACTGGCCCGGTTTATTGCCCATCGCC-3’ Infer a transcribed mRNA sequence first, identify the...

A DNA template has the following sequence:

5’-GCTTACTGGCCCGGTTTATTGCCCATCGCC-3’

Infer a transcribed mRNA sequence first, identify the start codon, and determine the complete amino acid sequence that would be translated. Be specific about the amino-terminus and carboxyl-terminus.

Homework Answers

Answer #1

As rna polymerase transcibes the template strand in from 3 ' to 5 ' so the mRNA will be as follows

5'-GGCG AUG GGC AAU AAA CCG GGC CAG UAA GC-3'

This will be the mRNA sequence .

However it will be in continuation but here for translation purpose we have spkitted it in codons. As AUG is the start codon so translation will be started from here and UAA is the stop codon so it will stop at it and the final aminoacid sequence will be as follows

Amino terminus-Methionine glycine aspartate lysine proline glycine glutamine-carboxyl terminus

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the...
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the mRNA molecule? The following sequence is located in the middle of an mRNA molecule past the first start codon, so that it is written in the correct reading frame (the first three nucleotides are the first codon, etc.) 5’ – UGC CUG ACA UGC AUC ACG UGG G – 3’. Translate this into a polypeptide (write the amino acid sequence), starting at the beginning...
The following template sequence of DNA was isolated from a bacterial cell. Identify the promoter region...
The following template sequence of DNA was isolated from a bacterial cell. Identify the promoter region (assume there is no operator) and transcribe the DNA to the right of the promoter. Once you’ve transcribed the DNA into mRNA, find the start codon and translate the sequence into the correct amino acids to create a polypeptide. 3’-AATATTTATTATATAACCCGGCATACGTTCGGACGTCCCATATAGACTCCATTCGACTT-5’
10. Given the following DNA sequence as the template strand: TTACGATGCCCA Finish the complementary DNA strand....
10. Given the following DNA sequence as the template strand: TTACGATGCCCA Finish the complementary DNA strand. AAT _ _ _ _ _ _ _ _ _ Finish the corresponding mRNA (use template strand) AAU _ _ _ _ _ _ _ _ _ Finish the corresponding protein sequence from the mRNA. (Use the table on mRNA codons to identify the protein sequence. For example, the mRNA codon AAU codes for the amino acid, asparagine, Asn. Asn-____-____-____ What would be the...
A portion of a protein-coding gene is provided for this question. Given the non-template DNA sequence...
A portion of a protein-coding gene is provided for this question. Given the non-template DNA sequence of 5'-TACTATGCTGAGCATTATTGCTAAGTGATGGCTA-3': a. Write the complementary template DNA sequence in a 5' to 3' direction. b. Write the mRNA sequence that would be transcribed from this segment of DNA in a 5' to 3' direction. c. Starting from the first start codon, write the polypeptide sequence that would be translated from the mRNA sequence. d. Define the following terms in your own words: frameshift...
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence...
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence of bases that in the complimentary strand of DNA? 2.) What is the mRNA that would be transcribed from this DNA?
Q2 An open reading frame (ORF) is a section of codons that begins with a start...
Q2 An open reading frame (ORF) is a section of codons that begins with a start codon and ends with a stop codon. Each codon specifies for a specific amino acid. ORF is the part of a gene that after transcription into an mRNA gets translated into a protein. With the help of several translation factors and enzymes, ribosomes translate mRNAs into proteins. The following DNA sequence contains a complete open reading frame (ORF) of a short transcriptional unit. The...
*A DNA template sequence is 3’ ATG 5’. The complimentary mRNA codon sequence is: A 5’...
*A DNA template sequence is 3’ ATG 5’. The complimentary mRNA codon sequence is: A 5’ TAC 3’      B 5’ UAC 3’      C 3’ TAC 5’      D 3’ UAC 5’
The top on is the normal DNA and the corresponding mRNA sequence. The bottom is the...
The top on is the normal DNA and the corresponding mRNA sequence. The bottom is the DNA and mRNA sequence after a mutation. Answer the following questions: NORMAL: Template DNA 5' - CA TAC GTA TTG CAG ATT - 3' mRNA 5' - __________________________________ MUTATED: Template DNA 5' - CA AC GTA ATT GCA GAT T - 3' mRNA 5' - _________________________________ (a) What is the amino acid sequence for the normal protein? (b) What is the amino acid sequence...
Write the mRNA that would form for the following section of DNA. For each codon in...
Write the mRNA that would form for the following section of DNA. For each codon in the mRNA, write the amino acid that would be placed in the protein by a tRNA. 3.1. DNA strand: 3’—CCC—TCA—GGG—CGC—5’ mRNA: —______—______—______—______— amino acid order _______—_______—_______—_______ 3.2. DNA: 3’—ATA—GCC—TTT—GGC—AAC—5’ mRNA: —______—______—______—______—______— amino acid order —_______—_______—_______—_______—_______ • If a base substitution in DNA ( G replaces C in DNA ) ,changes the second codon in mRNA, how is the amino acid sequence affected in the...
First, translate the following mRNA sequence into an amino acid sequence mRNA sequence : A U...
First, translate the following mRNA sequence into an amino acid sequence mRNA sequence : A U G U C C U U U U A A Amino acid sequence : ______ ______ ______ ______ Second, create a single base substitution in the second codon of the above mRNA sequence that: a) changes the resulting amino acid into a Cys ___________ b) causes a silent mutation ___________
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT