Question

The following template sequence of DNA was isolated from a bacterial cell. Identify the promoter region...

The following template sequence of DNA was isolated from a bacterial cell. Identify the promoter region (assume there is no operator) and transcribe the DNA to the right of the promoter. Once you’ve transcribed the DNA into mRNA, find the start codon and translate the sequence into the correct amino acids to create a polypeptide. 3’-AATATTTATTATATAACCCGGCATACGTTCGGACGTCCCATATAGACTCCATTCGACTT-5’

Homework Answers

Answer #1

Template strand sequence:
3'-AATATTTATTATATAACCCGGCATACGTTCGGACGTCCCATATAGACTCCATTCGACTT-5'

Coding strand sequence:
5'-TTATAAATAATATATTGGGCCGTATGCAAGCCTGCAGGGTATATCTGAGGTAAGCTGAA-3'

Promoter sequence: 5'-TATAAA-3'

The TATA box is generally situated around 25-35 bp upstream of the transcription start site.
In this case, it is located 17 bp upstream to the translation start site.

The mRNA coding sequence: 5'-AUGCAAGCCUGCAGGGUAUAUCUGAGGUAA-3'

The amino acid sequence: NH2-Met-Gln-Ala-Cys-Arg-Val-Tyr-Leu-Arg-COOH

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the...
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the mRNA molecule? The following sequence is located in the middle of an mRNA molecule past the first start codon, so that it is written in the correct reading frame (the first three nucleotides are the first codon, etc.) 5’ – UGC CUG ACA UGC AUC ACG UGG G – 3’. Translate this into a polypeptide (write the amino acid sequence), starting at the beginning...
A DNA template has the following sequence: 5’-GCTTACTGGCCCGGTTTATTGCCCATCGCC-3’ Infer a transcribed mRNA sequence first, identify the...
A DNA template has the following sequence: 5’-GCTTACTGGCCCGGTTTATTGCCCATCGCC-3’ Infer a transcribed mRNA sequence first, identify the start codon, and determine the complete amino acid sequence that would be translated. Be specific about the amino-terminus and carboxyl-terminus.
Transcribe and translate the following bacterial template DNA strand TACCCCAACTACCATATACTTCAAGAAATC mRNA Sequence: Protein Primary structure:
Transcribe and translate the following bacterial template DNA strand TACCCCAACTACCATATACTTCAAGAAATC mRNA Sequence: Protein Primary structure:
Given the following prokaryote sequence of DNA: Identify if any promoter sequences are present in DNA...
Given the following prokaryote sequence of DNA: Identify if any promoter sequences are present in DNA SEQ1 (Highlight/Underline these in the sequence) Predict the mRNA sequence that would arise from this DNA sequence. Identify the ribosome binding site, start and stop codons (if present). (Highlight/Underline these in the sequence). Predict the sequence of the peptide that would arise from the predicted mRNA sequence using the genetic code table (see Codon usage table). Based on your knowledge of the properties of...
A portion of a protein-coding gene is provided for this question. Given the non-template DNA sequence...
A portion of a protein-coding gene is provided for this question. Given the non-template DNA sequence of 5'-TACTATGCTGAGCATTATTGCTAAGTGATGGCTA-3': a. Write the complementary template DNA sequence in a 5' to 3' direction. b. Write the mRNA sequence that would be transcribed from this segment of DNA in a 5' to 3' direction. c. Starting from the first start codon, write the polypeptide sequence that would be translated from the mRNA sequence. d. Define the following terms in your own words: frameshift...
10. Given the following DNA sequence as the template strand: TTACGATGCCCA Finish the complementary DNA strand....
10. Given the following DNA sequence as the template strand: TTACGATGCCCA Finish the complementary DNA strand. AAT _ _ _ _ _ _ _ _ _ Finish the corresponding mRNA (use template strand) AAU _ _ _ _ _ _ _ _ _ Finish the corresponding protein sequence from the mRNA. (Use the table on mRNA codons to identify the protein sequence. For example, the mRNA codon AAU codes for the amino acid, asparagine, Asn. Asn-____-____-____ What would be the...
A. Using the genetic code table, answer the following questions: Determine the sequence of amino acids...
A. Using the genetic code table, answer the following questions: Determine the sequence of amino acids from an mRNA sequence CCGUGU Determine the sequence of amino acids from a DNA template strand AATGTT List the start codon List the stop codons
Q2 An open reading frame (ORF) is a section of codons that begins with a start...
Q2 An open reading frame (ORF) is a section of codons that begins with a start codon and ends with a stop codon. Each codon specifies for a specific amino acid. ORF is the part of a gene that after transcription into an mRNA gets translated into a protein. With the help of several translation factors and enzymes, ribosomes translate mRNAs into proteins. The following DNA sequence contains a complete open reading frame (ORF) of a short transcriptional unit. The...
You identify a gene from E. coli that is very small. Using recombinant DNA technology, you...
You identify a gene from E. coli that is very small. Using recombinant DNA technology, you managed to clone the whole piece of DNA that contains all codons (including stop and start codons) for protein synthesis. Using automated sequencing, you obtain the following sequence: 5’-TTAATATCAAGCTGATTCAGGCCCAAACATCCT-3’ A. Using the above sequence for reference, write out the mRNA transcript (be sure to label the 5' and 3' ends). B. Translate the protein that is coded for by the mRNA strand. C. How...
Below is the initial part of the gene sequence for  Glut1 as reported in Flybase. It includes...
Below is the initial part of the gene sequence for  Glut1 as reported in Flybase. It includes the 3' untranslated sequence and the first part of the translated sequence. The promoter for this gene is TATAT. Transcription begins with the third base after the promoter. For each answer portion, in your response, write each one starting on a new line and please write A, B, C, etc. as you go. A)   Transcribe and B). translate this sequence into its final peptide...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT