Question

The melting temperature of DNA is characteristic of the sequence of the DNA that is being...

The melting temperature of DNA is characteristic of the sequence of the DNA that is being melted. What can a melting curve tell you about the composition of bases within DNA? Explain how a melting curve is made, and what contributes to the relationship between temperature and DNA composition and sequence.

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

Melting temperature of DNA is the temperature at which 50% of double stranded DNA converts to single stranded DNA.

The melting curve is made by plotting a graph between temperature (at X-axis) and fraction of single stranded DNA (at Y-axis).

It gives a sigmoid shaped curve.

As the curve shifts to the right which means that the DNA melts at a higher temperature which in turns means that the force holding the two strands of DNA is greater which means that there are more G-C base pairs in the DNA.

G-C basepairs provide more stability to the DNA than the A-T basepairs because there is a tripple bond between guanine and cytosine whereas there is a double bond between the adenine and thiamine.

So more the G-C base pairs more the melting temperature of DNA and hence more shifting of melting curve towrds right side.

The picture below shows a rought sketch of melting curve.

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
Calculate the melting temperature in 1 M NaCl of the following pieces of DNA (the pieces...
Calculate the melting temperature in 1 M NaCl of the following pieces of DNA (the pieces of DNA are double stranded - I've just given the sequence of one of the two strands). Assume a total DNA strand concentration of 0.1 mM. Carry out the calculations using the salt-corrected Marmur-Doty equation, and then repeat them using the nearest neighbor thermodynamic parameters. Explain any discrepancies between the two calculations for each sequence.: a) CCGGAATTCCGG b) (AAGGTTCCGATACTGC)5 (note: the 5 is a...
What base sequence would pair with the following? 6pts AUGCCUAAAGUC Is the above sequence from DNA...
What base sequence would pair with the following? 6pts AUGCCUAAAGUC Is the above sequence from DNA or RNA? How can you tell
Neon, Argon, and Oxygen. Start with a temperature at which these substances are solids and slowly...
Neon, Argon, and Oxygen. Start with a temperature at which these substances are solids and slowly increase the temperature but do not reach the melting point. What can be said about the relationship between the temperature of a solid and the motion that the solid has?
Question 1: Explain what differential gene expression is. Question 2: Examine the following DNA template sequence...
Question 1: Explain what differential gene expression is. Question 2: Examine the following DNA template sequence from a eukaryotic gene, transcription starts with and includes the bold A, the bold sequence (CGTGTCCC) is an intron. 3' CTCCGATATATAAAGGGGTCAGTCTACCGCCTCACGTGTCCCTGCGGGTCACAATT5' Write out the mature mRNA sequence, include an explanation of each modification you made. (hint there are three modifications you have to make).
3. Genetic Information in E. coli DNA The genetic information contained in DNA consists of a...
3. Genetic Information in E. coli DNA The genetic information contained in DNA consists of a linear sequence of coding units, known as codons. Each codon is a specific sequence of three deoxyribonucleotides (three deoxyribonucleotide pairs in double-stranded DNA), and each codon codes for a single amino acid unit in a protein. The molecular weight of an E. coli DNA molecule is about 3.1 3 109 g/mol. The average molecular weight of a nucleotide pair is 660 g/mol, and each...
he genomes of three species of mice are being sequenced, and a particular DNA sequence found...
he genomes of three species of mice are being sequenced, and a particular DNA sequence found in all three species is found to have a steady mutation rate. The sequence of interest for these three species is shown below. Species A: ATTCGGATTATTCGAGG Species B: GTCCGGTTCATTGGACA Species C: ATCCAGATCGTTCGTGG Which of the following inferences can be made, based on this information? (2 points) Species B and Species C most likely diverged from Species A since they both have more mutations than...
**Can you guys tell me the logic behind finding the sequence patterns of each oligonucleotide... 2)...
**Can you guys tell me the logic behind finding the sequence patterns of each oligonucleotide... 2) Two sample tubes each contain about 100 nanograms (ng) of a 25-bp single-stranded oligonucleotide and 100 picograms (pg) of double-stranded genomic DNA (gDNA) from the same species. The tubes are heated to 95o C to allow the genomic DNA to denature and then cooled to allow the oligonucleotides to bind directly to the gDNA. The sequences of each oligonucleotide are shown below. Oligo 1...
Now slowly add heat to the sample of ice but do pass a temperature of 0...
Now slowly add heat to the sample of ice but do pass a temperature of 0 °C. What happens to the motion of the molecules as the temperature increases? Describe the changes in the motion in terms of the type of motion and the randomness of the water molecules motion. Make a conclusion. Try the other substances, which are Neon, Argon and Oxygen. Start with a temperature at which these substances are solids and slowly increase the temperature but do...
Describe the synthesis of DNA polymerase starting with the synthesis of the mRNA (transcription has already...
Describe the synthesis of DNA polymerase starting with the synthesis of the mRNA (transcription has already happened). Stop here and think about the protein DNA polymerase – what does it do? where does it function? (you should know this from general biology – if not, look it up!) Explain the details of how this protein is made and targeted to its final destination. Since you are starting with mRNA, be sure to discuss how the mRNA gets to the ribosome....
DNA Evidence: In a murder trial and expert witness is called to testify about DNA evidence...
DNA Evidence: In a murder trial and expert witness is called to testify about DNA evidence found at the crime scene. They say that the probability of a person randomly matching the DNA fragment found at the crime scene is approximately 1 in a million. In the cross examination the defense attorney asks what the probability of a lab mistake is during the processing of the evidence (contamination, human error, etc), to which the expert witness replies about 5% of...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT