Question

**Can you guys tell me the logic behind finding the sequence patterns of each oligonucleotide... 2) Two sample tubes each contain about 100 nanograms (ng) of a 25-bp single-stranded oligonucleotide and 100 picograms (pg) of double-stranded genomic DNA (gDNA) from the same species. The tubes are heated to 95o C to allow the genomic DNA to denature and then cooled to allow the oligonucleotides to bind directly to the gDNA. The sequences of each oligonucleotide are shown below.

Oligo 1 5’-CGCTAGGATCGAACCATACTCGGAC-3’

Oligo 2 5’-CATAGAATTTACGCATACCTAAGAT-3’

Oligo 3 5’-TACGTACGTACGCGTACGTACGTA-3’

(a) These oligonucleotides will anneal to a region of the genomic DNA that contains what sequence patterns? (2 points)

Oligo 1 - ______________________________________________

Oligo 2 - ______________________________________________

(b) While oligos 1 and 2 anneal to the gDNA, oligonucleotide 3 fails to bind to the gDNA sequence since it immediately forms double-stranded DNA as soon as the cooling begins. Briefly explain what is occurring with this oligonucleotide and why It cannot be used in further experiments that require binding to genomic DNA. (Hint: Look closely at the oligonucleotide sequence.)

Answer 1

Oligonucleotides 1 & 2 will anneal to a region of the genomic DNA that contains complementary base pairs.
That is specific bonding between A and T bases and between G and C bases.
So A goes with T, T with A, C with G and G with A. The direction of pairing will also be complementary

Oligo 1 (Original):..................CGCTAGGATCGAACCATACTCGGAC
Oligo 1 (gDNA Complement):3' - GCGATCCTAGCTTGGTATGAGCCTG - 5' ANSWER (a)

Oligo 2 (Original):..................CATAGAATTTACGCATACCTAAGAT
Oligo 2 (gDNA Complement):3' - GTATCTTAAATGCGTATGGATTCTA - 5' ANSWER (a)

Oligo 3 is a palindromic sequence which means that 2 copies of Oligo 3 bind to each other and hence are rendered useless for gDNA binding ANSWER (b)