Question

What base sequence would pair with the following? 6pts AUGCCUAAAGUC Is the above sequence from DNA...

What base sequence would pair with the following? 6pts AUGCCUAAAGUC Is the above sequence from DNA or RNA? How can you tell

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

Sequence : AUGCCUAAAGUC

Complementary sequence : TACGGATTTCAG

The given sequence is from a RNA molecule. This is evident because U indicates uracil, which is present in RNA as a replacement for thymine (present in the DNA). Transcription of a DNA strand causes the formation of a RNA strand. Guanine (G) pairs with cytosine (C). Thymine (T), which pairs with adenine (A) is replaced by uracil (U) in the RNA. So, the complementary base to adenine will be uracil in a RNA strand.

Please note that the given complementary sequence is from a view point of DNA. This complementary sequence will produce the given RNA strand when transcribed.

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence...
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence of bases that in the complimentary strand of DNA? 2.) What is the mRNA that would be transcribed from this DNA?
2.If the following DNA sequence was the template for transcription, what RNA sequence would be synthesized?...
2.If the following DNA sequence was the template for transcription, what RNA sequence would be synthesized? 3' GTCCATCAT 5'
11. Assuming that there is a mutation such that the new sequence would be: DNA: TTAGCTAGATAAAACCGGCCCACGTTCTTACTTTT...
11. Assuming that there is a mutation such that the new sequence would be: DNA: TTAGCTAGATAAAACCGGCCCACGTTCTTACTTTT What would be the effect on the sequences of the mRNA & tRNA & the final protein’s sequence? mRNA: transcribe mRNA using the following from the DNA string: T=A, A=U, G & C pair tRNA: transcribe tRNA using the following from the mRNA string: A & U pair, G & C pair Protein: using the Condon chart and the mRNA strand. What I do...
5' AGTTGTATAGAAAACTGCGAA 3' What DNA sequence (give as 5' to 3') would be formed by replicating...
5' AGTTGTATAGAAAACTGCGAA 3' What DNA sequence (give as 5' to 3') would be formed by replicating the sequence shown above? What RNA sequence (give as 5' to 3') would be formed by transcribing the sequence formed in part 1? What protein sequence (give as N to C terminus) would be formed by translating the sequence formed in part 2?
A base substitution that changed a DNA sequence of TGT to TGG would cause a __________...
A base substitution that changed a DNA sequence of TGT to TGG would cause a __________ mutation. silent nonsense frameshift missense Bacteria that can naturally take up free DNA and recombine it into their chromosome are called ______________. competent F+ cells transduced transformed
The melting temperature of DNA is characteristic of the sequence of the DNA that is being...
The melting temperature of DNA is characteristic of the sequence of the DNA that is being melted. What can a melting curve tell you about the composition of bases within DNA? Explain how a melting curve is made, and what contributes to the relationship between temperature and DNA composition and sequence.
DNA Replication 1. Define DNA replication. 2. What is the role of base pairing in DNA...
DNA Replication 1. Define DNA replication. 2. What is the role of base pairing in DNA replication? Would this process of replication be possible without base pairing? 3. Describe the process of semi-conservative DNA replication. 4. Describe the experiment that led to the discovery that DNA was replicated through a semi-conservative process. 5. Define replication origins. 6. Why is the specific sequence of the replication origin relevant to DNA replication? 7. Describe the process of DNA replication, including the enzymes...
Given the following DNA sequence, what is the mRNA sequence? How many amino acids would be...
Given the following DNA sequence, what is the mRNA sequence? How many amino acids would be created from this strand of DNA? TAC GGC CTA TAC GTA Please explain this process, don't just write the answer. I think it will be ARG CCG GAT ATG CAT, but I'm not sure. How would I know how many amino acids would be created? My teacher didn't really explain that part to me.
The bond that links a base to a sugar is a glycosidic bond. What is the...
The bond that links a base to a sugar is a glycosidic bond. What is the name of the kind of bond that links a sugar to a phosphate group? Define the primary structure of DNA/RNA. Compare and contrast to the primary structure of proteins. In proteins, a peptide read from the N terminal to the C terminal. Is there a kind of direction in DNA/RNA as well? Briefly explain. Give the equation for Chargaff’s rules. What does it mean?...
The transcription of a gene involves copying DNA nucleotides from DNA into a sequence of RNA...
The transcription of a gene involves copying DNA nucleotides from DNA into a sequence of RNA nucleotides. Many regulatory factors can help facilitate the transcription processes. One region that affects transcription is the terminator region, which is located on mRNA, downstream of the coding segment on DNA, in the 5' end of the gene on DNA, downstream of the coding segment on mRNA at the 5' end on DNA, within the coding region
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT