Question

11. What is the resting level of calcium inside the cell and the level outside the...

11. What is the resting level of calcium inside the cell and the level outside the cell?

A. What systems keep calcium low in the cytosol?

What pumps are involved?

How are mitochondria involved?

B. What are the different ways calcium levels increase in the cytosol?

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

Question

11. The resting level of the calcium inside the cell is 100 nano meter and it's 10000 times of 100 nm (manometer).  

A. There is a calcium pump present in the plasma membrane that keep low calcium in the cytosol. The system include the use of ion transporters that uses active transport to flow the calcium across the cell membrane.

Mitochondria are involved as they provide energy to transport calcium across the membrane.

B. The different ways calcium level arise are:

I. During muscle contraction

II. During hormone release in the blood.

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
1.)ATP is hydrolyzed when protein __________ transfer solutes from outside of the cell to the inside....
1.)ATP is hydrolyzed when protein __________ transfer solutes from outside of the cell to the inside. This is a(n) _____________ transport process. a) receptors; passive b) pumps; active c) cell-adhesion molecules; active d) channels; active e) cell-identity markers; passive 2.)A neurotransmitter (NT) is released into the synaptic cleft when _________ enters the synaptic knob and the N.T is broken down by __________ on the post-synaptic membrane. a) calcium; hexokinase b) potassium; voltage gates c) calcium; an enzyme d) sodium; an...
An elderly patient’s blood calcium level is within normal limits (9 mg/dL – 11 mg/dL).  Can we...
An elderly patient’s blood calcium level is within normal limits (9 mg/dL – 11 mg/dL).  Can we assume that the patient does not have osteoporosis? Explain why or why not in your answer. Please describe the hormones and cells involved with calcium balance. Your answer should include these terms: Parathyroid hormone, Calcitonin, Osteoblast, Osteoclast. increase bone density, decrease bone density
An ion channel is a cell membrane channel that is selectively permeable to specific ions, such...
An ion channel is a cell membrane channel that is selectively permeable to specific ions, such as calcium, potassium, and sodium. There are different types of ion channels such as a potassium leak channel, which creates a negative charge inside of the cell, but can an ion channel be gated since it selects certain ions? And if yes, then how and what ways can it be gated?
The given situation is in regards to a single cell with cellular dysfunction and it's showing...
The given situation is in regards to a single cell with cellular dysfunction and it's showing these symptoms: Decreased pH in cytosol below the normal range 2. Decreased pH in mitochondria below the normal range 3. Increase in ATP 4. Increase in Hydrolysis 5. Decreasing levels of Glycogen and Triglycerides 6. Inherited Autosomal Recessive Mutation of hydrolytic enzymes (inherited at the organismal level, but impacts the single cell found in a tissue) - Normal portion of gene: ATGCCCGCCCGCCGTTAGGCATCGCA - Mutated...
Part A A balloon is floating around outside your window. The temperature outside is -11 ∘C...
Part A A balloon is floating around outside your window. The temperature outside is -11 ∘C , and the air pressure is 0.700 atm . Your neighbor, who released the balloon, tells you that he filled it with 4.90 moles of gas. What is the volume of gas inside this balloon? Part B A 10.0 L gas cylinder is filled with 5.60 moles of gas. The tank is stored at 25 ∘C . What is the pressure in the tank?...
1)Describe two different ways that a GABA receptor could depolarize the postsynaptic cell. 2)Define voltage clamping....
1)Describe two different ways that a GABA receptor could depolarize the postsynaptic cell. 2)Define voltage clamping. In voltage clamping experiment, it was determined that there is an early and late current. What ion is associated with each of these currents and what direction does it move in? 3)What is the target of tetanus toxin and botoulinium toxin? Why does one produce a rigid paralysis and the other a flaccid paralysis? Sarin blocks the effects of acetylcholinestrase . 4)How would this...
Human Anatomy & Physiology-Assignment 4 Chapter 11 A muscle fiber is ________. A) a muscle cell...
Human Anatomy & Physiology-Assignment 4 Chapter 11 A muscle fiber is ________. A) a muscle cell B) a rod-like structure consisting of sarcomeres placed end to end C) an arrangement of actin and myosin filaments deep within a muscle cell D) the elaborate arrangement of smooth endoplasmic reticulum inside a muscle cell What is the correct order of structures as you move from outside a muscle cell, to deep inside it? A) myofibril, myofilament, fiber B) myofilament, fiber, myofibril C)...
Cell biology 1. Briefly describe what occurs in the four phases of the cell cycle (G1,...
Cell biology 1. Briefly describe what occurs in the four phases of the cell cycle (G1, S, G2, M). 2. How does cyclin regulate cyclin-dependent kinases (Cdks)? Why do Cdks require cyclin? 3. Mitogens are involved in cell signaling pathways which promote cell division by the production of cyclin. Using the figure 18-14 from your book (which is on the right), answer whether the expression of genes required for cell proliferation will be increased or decreased under the following scenarios....
Children that suffering from attention deficient disorder may have a high level of energy but a...
Children that suffering from attention deficient disorder may have a high level of energy but a low level of attention span. The other symptoms that are associated with "Attention Deficit Disorder or ADHD are, inattention, impulsiveness, a low tolerance for frustration, and generally a great deal of inappropriate behavior." (Feldman) At one time or another, most children will display one or more of these traits but if you are a child that has been diagnosed with ADHD, you can not...
7. Which of the following ion(s) is in highest concentration outside the neuron cell membrane in...
7. Which of the following ion(s) is in highest concentration outside the neuron cell membrane in a resting state? a. Chloride (Cl) and potassium (K) b. Potassium (K) only c. Magnesium (Mg2) d. Chloride (Cl) and sodium (Na) e. Nitric oxide (NO) 8. A neurotransmitter may be described as “excitatory” (leads to depolarization) or “inhibitory” (no change or hyperpolarization). Which of the following determines the action of the neurotransmitter? a. The type of charges (or¨)on the neurotransmitter b. The type...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT