Question

How could you offer support to parents of newborns whose APGAR scores indicate they may be...

How could you offer support to parents of newborns whose APGAR scores indicate they may be in danger?

Homework Answers

Answer #1

APGAR SCORE is used for assessing the new born babies immediately after birth and checked at 1 minutes and 5 minutes of birth. APGAR indicates A stands for appearence, P stands pulse, G stands for Grimace, A stands for activity an dR satnds respirtaion.it got scale of 0,1,2. total score is 10, normally the child shows rate of 7-10 and mild deprssion child shows rate 4-6, Severe depression shows rate of 0-3.

when the child shows the rate 0-3 that indicates severe depression.and danger situation.

there are some reaction from parent side. they are fear, helplessness, irritable, tries to want to be with their child, difficult to concentrate, trouble eat and sleep and maintaining personal hygiene, feeling guilty, no idea about time, day.

these reaction must be kept in mind before establishinng rapport ith family. because health provider acts as strenth giver, information giver,stress dealer.

therapeutic relationship :before giving support, the nurse is a poistion to create a therapeutic relationship with the family.allow them to speak freely and be a good listener.and never a advocator for family. sitting close to them and by touching. these method allow family  to bind a relationship with the nurse.

showing professionalism:the nurse should show peacefulness and positive attitude increases confident of a family. the health provider shows respect to parents, that increases positive feeling to parents.

telling factual information: the parents are informed about the neonatal intensive care unit, environment, treatment that are provided to the newborn. the nurse avoid vague answer and behave like busy staff

meeting: arrange a meeting with their physician and explain the reason for the danger

rest and sleep: parents are allowed to have rest and diet to maintain their ability and concentrate on information which is provided by health provider.

communication:allow them to speak with their relatives and friends that creates emotional support and reduces their anxiety

visit: allow them to visit their child who is intensive care unit. explain about monitor, tubes ,condition in a simple and understanding way. this helps to have better under standing of their child condition and competence of health provider

grievences: nurse should maintain silence if the parents shows anger. never argue with them and allow them to express their feeling. there by health care provider can give emotional support to them who are depressed. parents are allowed to accept factual information. nurse must not provide assumed information.the nurse should avoid criticizing parent's behaviour

counselling: parents are given counselling for 6 months in subsequent visit  if they are not able to cope up grief.

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
Why is the APGAR score used to assess a newborn twice, at one and five minutes...
Why is the APGAR score used to assess a newborn twice, at one and five minutes after birth (include at least one reference)? At one minute? At five minutes? Twice? What does it mean if a newborn receives the following scores? Include: Is the newborn in danger? How should the providers respond to the scores (include at least one reference?   A score of 4 at 1 minute and 7 at 5 minutes? A score of 2 at 1 minute and...
How would you identify nursing preceptors who could offer a positive experience?
How would you identify nursing preceptors who could offer a positive experience?
You may need to use the appropriate technology to answer this question. The College Board provided...
You may need to use the appropriate technology to answer this question. The College Board provided comparisons of Scholastic Aptitude Test (SAT) scores based on the highest level of education attained by the test taker's parents. A research hypothesis was that students whose parents had attained a higher level of education would on average score higher on the SAT. The overall mean SAT math score was 514.† SAT math scores for independent samples of students follow. The first sample shows...
How would you comfort a parent whose infant had died from SIDS? Provide the name of...
How would you comfort a parent whose infant had died from SIDS? Provide the name of a support group in your local area to assist parents and other family members who have lost a baby due to SIDS. 300-350 words
You are screening newborns to see if they have the progerin gene mutation or not.  Describe how...
You are screening newborns to see if they have the progerin gene mutation or not.  Describe how you would use FISH as a diagnostic toolfor this disease. What technique could you use to see if the progerin protein or normal Lamin A protein was being expressed.  For both, explain the technique and how you would determine which protein the patient expressed (the normal or progerin). Everything you need to know about the progerin gene and protein is in the Human Connections section....
Explain how riboswitches function. (6) 6.2 Indicate if you think the RNA sequence below could be...
Explain how riboswitches function. (6) 6.2 Indicate if you think the RNA sequence below could be part of a riboswitch mechanism and explain why. Strand 1: AUGCCAUAGCUUCGAUGGGCAUCGAAGCUAUGGCGAGAUUUCGAAGCUA
Your parents' car requires $4,000/yrto maintain when you leave for college. You could replace it with...
Your parents' car requires $4,000/yrto maintain when you leave for college. You could replace it with a newer car costing $12,000. Both vehicles will survive through college (i.e. 4 yrs) and will die when you graduate. If your opportunity cost is 8%, by how much would the maintenance cost decrease to justify the purchase?
What type serduct integration products could a new liquor store offer? The question says show how...
What type serduct integration products could a new liquor store offer? The question says show how you can expand your product offerings by building services around your products? The product is a new liquor store
-How you could "dispute" potential irrational thoughts/beliefs you may have (personally, in your own life) that...
-How you could "dispute" potential irrational thoughts/beliefs you may have (personally, in your own life) that hinder your progress or confidence, and give at least one example of more rational/effective self-talk that could take its place. -What did you learn about yourself in terms of the choices you are making in your life and how they impact your overall health and wellness? What areas in your life might need different choices to be made for optimal health?
How do you calculate: how much do the firm left if they shut down. Please indicate...
How do you calculate: how much do the firm left if they shut down. Please indicate what formula and what methods should I use If you can use graphs or examples to support your explanation, that would be great.
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT