Question

According to the text, what is the general ping sequence to identify connectivity issues?

According to the text, what is the general ping sequence to identify connectivity issues?

Engineering   Computer-Science   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

Please Upvote, if you are impressed with the answer.

If you have any doubt, you can comment.

Answer:

ping is the one of better network debugging tool available. ICMP echo function is used in the implementation of ping.

Ping places a unique sequence number on each packet it transmits, and reports which sequence numbers it receives back. Thus, you can determine if packets have been dropped, duplicated, or reordered. Ping checksums each packet it exchanges. You can detect some forms of damaged packets. Ping places a timestamp in each packet, which is echoed back and can easily be used to compute how long each packet exchange took - the Round Trip Time (RTT). Ping reports other ICMP messages that might otherwise get buried in the system software. It reports, for example, if a router is declaring the target host unreachable.

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
QUESTION 1 If you have a workstation that cannot connect to a server, what is the...
QUESTION 1 If you have a workstation that cannot connect to a server, what is the first test you could perform to establish whether the cabling is OK? a Ping the loopback b Ping sweep the entire network. c Yell at IT to fix it. d Ping another local system e ipconfig QUESTION 21 What is the correct sequence to ping items to identify connectivity issues? A. 1. Establish Connection 2. Ping Host Name 3. Ping Remote Host 4. Ping...
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation...
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation occurred. (insertion, deletion, or substitution) Identify what type of protein change resulted. (frameshift, missense, nonsense, or silent) Normal Sequence 3’ TACCTTCACCGCAGGGTAGCTTTTATTTAA 5’ Mutated sequence 3’ TACCTTCACCGCAGGTAGCTTTTATTTAA 5’
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation...
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation occurred. (insertion, deletion, or substitution) Identify what type of protein change resulted. (frameshift, missense, nonsense, or silent) normal sequence- 3' TAC GGA GCA GGG CCA AAA AAC TGT TTT ACT 5´ mutated sequence- 3´ TAC GGA GCA GGG CCA CCA AAC TGT TTT ACT 5´
For the following data, identify what are the text qualifiers and delimiters. If a text qualifier...
For the following data, identify what are the text qualifiers and delimiters. If a text qualifier or delimiter is not used, answer "none." Flat file, Header Row: DocumentNum;BankName BankAddress;DocumentDescription Flat File Data Row: 331-12;"First Bank" "429 Taylor St. Haines City, FL 33844";"Loan Agreement"
According to the text. what are a few (three) stariges for imorving life satisfaction ? brief
According to the text. what are a few (three) stariges for imorving life satisfaction ? brief
Picture yourself as a different race. According to your textbook, what are some of the issues...
Picture yourself as a different race. According to your textbook, what are some of the issues faced by this population? Would your health risks be any different than they are now? What is the importance of understanding other people’s health risks and issues, not just your own?  Use college-level writing.   Your original post must be a minimum of 250 words.  You MUST include reference material (either from the module and/or from SUITABLE external sources) AND provide BOTH appropriate in-text citations AND full-source...
What are the general issues related to deciding whether to use a test of controls approach...
What are the general issues related to deciding whether to use a test of controls approach or a substantive approach?
What are the major competitive issues General Electric faces when managing cooperative strategies?
What are the major competitive issues General Electric faces when managing cooperative strategies?
L. According to the authors of your text, what was the “Trojan horse” of Deng Xiaoping’s...
L. According to the authors of your text, what was the “Trojan horse” of Deng Xiaoping’s teachings that brought institutional change that restored capitalism to China? (See page 156).) Why? Were the Chinese leaders aware of this?
According to the text, what is the difference between these two mathematical statements? \bar{v} \Delta t...
According to the text, what is the difference between these two mathematical statements? \bar{v} \Delta t v ¯ Δ t \bar{v} * \Delta t
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT