Question

When double stranded DNA is heated, the strands separate. This strand separation can be monitored in...

When double stranded DNA is heated, the strands separate. This strand separation can be monitored in the lab by ______ .

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

The denaturation of DNA causes hyperchromicity. Hyperchromicity is the material's increasing ability to absorb light. The temperature at which DNA strand get separated can be monitored by absorbance at 260 nm while heating. As the temperature has increased the absorbance is increased and after a certain temperature, DNA gets completely denatured into single-stranded DNA. The absorbance is measured by a spectrophotometer. DNA denaturation can be monitored by the change in A260.

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
Listed below are two different single strands of DNA. Which of these, in their double-stranded form...
Listed below are two different single strands of DNA. Which of these, in their double-stranded form would you expect to be cleaved by a restriction enzyme? a) CTCGCCAATTGACTCGTC b) ACTCCACTCCCGACTCCA For each answer explain why or why not, using the bases of the specific example.
1. draw both the double stranded DNA molecules after replication has occured. show both the parent...
1. draw both the double stranded DNA molecules after replication has occured. show both the parent and daughter strand, are any nucleotides missing? why? 2. What proteins could you use to seperate DNA strands and keep them seperated?
Some Steps in the Replication of a Gene Two strands of DNA separate Two strands of...
Some Steps in the Replication of a Gene Two strands of DNA separate Two strands of DNA form a double helix DNA ligase bonds nucleotides together DNA nucleotides match up with complementary bases The order in which the steps in the replication of a gene occur is
3. When the base composition of double-stranded DNA from Micrococcus luteus was determined, 37.5% of the...
3. When the base composition of double-stranded DNA from Micrococcus luteus was determined, 37.5% of the bases were found to be cytosine. What is the percentage of adenine in the DNA of this organism? _____ % adenine 4. A region along a DNA strand that is transcribed contains no A. What base will be missing in the corresponding region of the mRNA? _____________
The UV absorbance of a solution of a double-stranded DNA is monitored at 260 nm as...
The UV absorbance of a solution of a double-stranded DNA is monitored at 260 nm as a function of temperature. Data appear in the following table, where temperature (T) and absorbance (measured at 260 nm) are shown. From the data determine the melting temperature. T(K): 343 348 353 355 357 359 361 365 370 Absorbance: 0.3 0.35 0.5 0.75 1.22 1.40 1.43 1.45 1.47 Note: Please remember that you use highly concentrated samples where absorbance can be as high as...
Here is the nucleotide sequence of one strand of a fragment of double-stranded DNA, which will...
Here is the nucleotide sequence of one strand of a fragment of double-stranded DNA, which will be amplified by PCR using short primers:      5' TGGCAGTCGATGCTGCTAGCTGGCCTTGAGTCGTGC 3'      Primers that could be used to amplify this entire DNA fragment are: A) 5’ GACTGCCA 3’ & 5’ GCACGACT 3’ B) 5’ GACTGCCA 3’ & 5’ AGTCGTGC 3’ C) 5’ TGGCAGTC 3’ & 5’ GCACGACT 3’ D) 5’ TGGCAGTC 3’ & 5’ AGTCGTGC 3’ E) 5’ TGGCAGTC 3’ & 5’ CGTGCTGA 3’
During the PCR reaction, the DNA sample is heated in order to separate it into single...
During the PCR reaction, the DNA sample is heated in order to separate it into single strands. allow primers to bind. synthesize RNA. allow DNA polymerase to work.
Messelson and Stahl, determined that when DNA replication is completed, a)each new DNA double helix consists...
Messelson and Stahl, determined that when DNA replication is completed, a)each new DNA double helix consists of one old DNA strand and one new DNA strand b)each of the four DNA strands consists of some old strand parts and some new strand part one DNA double helix consists of two old strands and one DNA double helix consists of two new strands The Meselson-Stahl experiment was designed to answer which question? How does DNA replicate? What does the secondary structure...
Which of the following statements about the structure of double-stranded DNA is FALSE? 1. DNA is...
Which of the following statements about the structure of double-stranded DNA is FALSE? 1. DNA is stabilized primarily by H-bonding between the bases. 2. Only non-covalent forces stabilize the helix so that the DNA can unwind during replication and transcription. 3. The phosphodiester backbone interacts with Mg2+ in the cell. 4. Some groups of the bases are exposed in the grooves of double-stranded DNA.
Anthropology lab. DNA structure and function The illustration below represents a portion of the DNA strand...
Anthropology lab. DNA structure and function The illustration below represents a portion of the DNA strand for production of hemoglobin’s beta chain. The strands are in the process of separating for transcription. Transcribe and translate the entire shaded portion into an mRNA strand, and using the genetic code chart (Fig. 2.20), translate it into a part of the hemoglobin protein. DNA strand   _____   _____   _____   _____   _____   _____   _____   _____   _____   _____   _____   _____   _____   _____   _____   _____   _____   _____...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT