Question

Vector unpacking is generally assumed to be necessary for DNA release and gene expression, but the...

Vector unpacking is generally assumed to be necessary for DNA release and gene expression, but the extent to which dissociation affects gene delivery is unclear.

detail . what is "Vector unpacking "??????

Homework Answers

Answer #1

In laboratory experiments plasmid DNA is transfected in to the target cells by using lipoplex or polyplex mediated delivery (where polycation condenses DNA and facilitate its entry in to the cells).

These polyplex complexes are taken up by cells by endocytosis. Once these polyplex complexes enter the nucleus, inorder to be processed by RNA polymerases, the DNA has to be dissociated from the polycation complex to undergo transcription.

This last step where polyplexes disassemble to allow the transcription apparatus of the cell to access the DNA efficiently to promote gene expresssion is called as Vector unpacking.

The more the dissociation, the more effective will be gene delivery and transcription.

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
what are the effects of a dna mutation on gene expression
what are the effects of a dna mutation on gene expression
Genetics: What is the importance of controlling gene expression in the molecular pathway from DNA to...
Genetics: What is the importance of controlling gene expression in the molecular pathway from DNA to RNA to Protein in Eukaryotic cells?
At which site on the DNA of a gene does RNA polymerase release its newly made...
At which site on the DNA of a gene does RNA polymerase release its newly made RNA? Choose one: A. poly-A tail B. stop codon C. promoter D. TATA box E. terminator
A functional genomics experiment is carried out using a DNA microarray to characterize gene expression in...
A functional genomics experiment is carried out using a DNA microarray to characterize gene expression in cancer cells. First, control RNA is isolated from normal skin cells, reverse transcribed to DNA and labeled with green fluor. Then, RNA is isolated from a melanoma (skin cancer tumor), reverse transcribed, and labeled with red fluor. The samples are mixed and hybridized to the microarray. What can you conclude about the behavior in tumor cells for any particular gene (spot on the microarray)...
Question 1: Explain what differential gene expression is. Question 2: Examine the following DNA template sequence...
Question 1: Explain what differential gene expression is. Question 2: Examine the following DNA template sequence from a eukaryotic gene, transcription starts with and includes the bold A, the bold sequence (CGTGTCCC) is an intron. 3' CTCCGATATATAAAGGGGTCAGTCTACCGCCTCACGTGTCCCTGCGGGTCACAATT5' Write out the mature mRNA sequence, include an explanation of each modification you made. (hint there are three modifications you have to make).
General Biology lab report of Gene Expression and DNA Technology please make sure to give more...
General Biology lab report of Gene Expression and DNA Technology please make sure to give more details Q3). Frameshift mutations occur when you add or delete bases in multiples other than 3 at a time. Frameshift Mutation please make sure to make a chart for TAC GGA TGG CTA ATG GTA CTC DNA: TAC GGA TGG CTA ATG GTA CTC mRNA: amino acid sequence: Q4). How does this polypeptide differ from the normal polypeptide on the Frameshift Mutation continuing question...
Part 1: Click on the box that says “Expression.” You are presented with a gene that...
Part 1: Click on the box that says “Expression.” You are presented with a gene that contains a regulatory region and a transcribed region. Your goal is to produce 3 proteins from each of three genes. The proteins are indicated by the shapes in the box at the top right. You need to successfully transcribe each gene, and then translate the message from the gene into a protein using your knowledge of how these processes work. GENE 1 Questions What...
29) The light dependent reaction has 2 products which are necessary for the Calvin cycle (light...
29) The light dependent reaction has 2 products which are necessary for the Calvin cycle (light independent reaction). What are these products?         A. CO2 and chlorophyll    B. Water and CO2    C. NADPH and ATP    D. NADPH and CO2 30) Certain proteins are made early in your lifetime and then turned off - temporal gene expression. An exception to this rule can be found in societies who learned to domesticate animals. These pastoral societies had a selective advantage if...
Control of Gene Expression 1. How is it possible that individual cells of a multicellular organisms,...
Control of Gene Expression 1. How is it possible that individual cells of a multicellular organisms, which contain all the same DNA, can be so different from one another? 2. What are housekeeping proteins? What are their roles in the cell? 3. Describe the ways in which cells control gene expression. 4. How does control of transcription in prokaryotes and eukaryotes differ? 5. What is the role of operons in the prokaryotic genome? 6. A rare mutation occurs in bacteria...
9. What does a viral DNA become after being associated with the bacterial chromosome?   A. gene                  ...
9. What does a viral DNA become after being associated with the bacterial chromosome?   A. gene                   B. Prophage                       C. Plasmid                             D. Plaque 10. A positive-strand RNA virus:                                                                                                                         A. must first be converted to a mRNA before it can be translated.                                                                 B. can be used directly to translate viral proteins.                                                                                            C. will be degraded by host enzymes.                                                                                                                D. is not recognized by host ribosomes. 11. Which of the followings cannot be used to culture viruses?                                                                         A. tissue culture      B. liquid...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT