Question

The unique base in the DNA of the T-even bacteriophages, 5- hydroxymethylcytosine. The site of glucosylation...

The unique base in the DNA of the T-even bacteriophages, 5-
hydroxymethylcytosine. The site of glucosylation is shown. What
is the purpose of this glucosylation or base modification event
during the lytic cycle?

Homework Answers

Answer #1

Ans.Evolution allowed several bacteriophages to survive in which modified bases which are resistant to many restriction enzymes are incorporated into their genome. One such modification is, modification of cytosines to 5-hydroxymethylcytosine (5hmC) and it can be further modified by α and β glucosylation of the hydroxymethyl group.

Even though 5hmC is resistant to most restriction enzymes, McrA , McrBC and Type IV SauUSI have been shown to specifically restrict its infection in vivo

Primary function of modifications in phage genomes is to prevent cleavage by host restriction endonucleases.

DNA modifications in phage DNA are have other functions also-

  • the regulation of operon expression, as demonstrated in the Bacillus phage SPO1 and the coliphage T4
  • initiation of DNA packaging into the viral capsid, as shown in coliphage P1.
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
1) 5-Bu is a base analog of the nucleotide (T). If 5-Bu is incorporated during DNA...
1) 5-Bu is a base analog of the nucleotide (T). If 5-Bu is incorporated during DNA replication opposite an A (it's normal base pairing), show below how it can result in a mutation during subsequent replications. What kind of mutations arise, transitions, or transversions? Draw your diagram carefully and neatly! 2) An E.coli mutant strain synthesizes ß-galactosidase whether or not the inducer is present. What two genetic defects (mutations) might be responsible for this phenotype (list both; these are mutations...
A mutation has occurred in the DNA binding sequence for p53. The binding site is Pu-Pu-Pu-C-A/t-T/a-G...
A mutation has occurred in the DNA binding sequence for p53. The binding site is Pu-Pu-Pu-C-A/t-T/a-G Py-Py-Py; and is converted to Pu-Pu-Pu-T-A/t-T-A/t-T/a-G Py-Py-Pu in the promoter of the Mdm2 gene. What base would be methylated? What would be the effect of such a mutation on methylation ? What could be the effect of such a mutation on p53 binding? And, why? How would the expression of Mdm2 be affected ?
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence...
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence of bases that in the complimentary strand of DNA? 2.) What is the mRNA that would be transcribed from this DNA?
Now consider a sequencing method where bases (A, T, C, or G) are each “read” as...
Now consider a sequencing method where bases (A, T, C, or G) are each “read” as a polymerase incorporates them cycle by cycle into a template strand of DNA. Many strands of DNA are sequenced simultaneously. - During each cycle, the polymerase will incorporate either one nucleotide or no nucleotide, and fresh polymerase is supplied after each cycle (so you do not have to worry about enzyme lifetime). The probability of incorporation is called the efficiency of the polymerase. -...
1.When a protein binds to DNA at a site defined by a particular nucleotide sequence, with...
1.When a protein binds to DNA at a site defined by a particular nucleotide sequence, with which parts of the DNA does the protein primarily interact? A. the phosphate and deoxyribose groups in the DNA backbone B. the phosphate and deoxyribose groups in the DNA backbone, and hydrophobic interactions with the nucleotide bases C. nucleotide bases within the major grooves of the DNA D. nucleotide bases within the major and minor grooves of the DNA E. none of the above...
Question 1 Complementary base pairing is the result of Question 1 options: hydrogen bonding the fact...
Question 1 Complementary base pairing is the result of Question 1 options: hydrogen bonding the fact that complementary bases fit together physically covalent bonding ionic bonding the fact that strands of DNA are wound around each other in a double helix Question 2 During DNA replication, the function of RNA primers is to Question 2 options: open replication bubbles serve as starting points for DNA strand elongation by DNA polymerase I in the 3' - 5' direction serve as starting...
1. Chain terminators block further DNA synthesis because they are missing which of the following? Group...
1. Chain terminators block further DNA synthesis because they are missing which of the following? Group of answer choices A. 3' OH B. 5' phosphate C. A fluorescent dye 2.The cycle sequencing reaction generates: Group of answer choices A. Fragments of the same size; because the chain terminator integration site is the same in each newly synthesized fragment B. Fragments of the same size; because the chain terminator integration site can be different in each newly synthesized fragment C. Fragments...
5. Draw a chain of two nucleotides, indicating the base used for each, and the location...
5. Draw a chain of two nucleotides, indicating the base used for each, and the location of the ester bonds between them. a. Draw an incoming deoxycytosine triphosphate molecule, placing a box around the atoms that will be released during the chemical reaction of polymerization. b. Do you think this reaction is reaction is endergonic (energy absorbing) or exergonic (energy releasing)? Why? 6. S-CDK (cyclin A-CDK1) promotes the disassembly of the pre-RC by phosphorylating Cdc6 (targeting Cdc6 for degradation) and...
Required information Exercise 5-16 Break-Even Analysis and CVP Graphing [LO5-2, LO5-4, LO5-5] [The following information applies...
Required information Exercise 5-16 Break-Even Analysis and CVP Graphing [LO5-2, LO5-4, LO5-5] [The following information applies to the questions displayed below.] The Hartford Symphony Guild is planning its annual dinner-dance. The dinner-dance committee has assembled the following expected costs for the event: Dinner (per person) $ 13 Favors and program (per person) $ 3 Band $ 1,000 Rental of ballroom $ 600 Professional entertainment during intermission $ 400 Tickets and advertising $ 2,000 The committee members would like to charge...
1. Which of the following is true about binary fission? Group of answer choices A the...
1. Which of the following is true about binary fission? Group of answer choices A the original two chromosomes in a bacterial cell each replicate and are placed into two new cells B the chromosome is copied, then attaches to the cell membrane by spindle fibers C there is no nuclear membrane to break down and reform D lysis of the existing cell wall of bacteria occurs during the process 2. DNA:   Group of answer choices A replication is described...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT