Question

Comment of the structure of another template system in use with Express.

Comment of the structure of another template system in use with Express.

Homework Answers

Answer #1

Let's take an example of using ExpressJS web framework for NodeJS.

People may use ExpressJS to put their environments like development, production or test, and also their routes etc. on the app.js. But that's not a good practice as when it comes to a large scale application, app.js then will be also too large to handle.

The following directory structure would work perfectly instead:

| my-application
| -- app.js
| -- config/
     | -- environment.js
     | -- routes.js

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
use ATI learning template System Disorder for Tuberculosis
use ATI learning template System Disorder for Tuberculosis
There is a tradeoff between capital structure and flexibility; Comment.
There is a tradeoff between capital structure and flexibility; Comment.
SYSTEM DISORDER TEMPLATE ON NEUTROPENIA PRECAUTIONS AND SARCOMAS
SYSTEM DISORDER TEMPLATE ON NEUTROPENIA PRECAUTIONS AND SARCOMAS
ATI active learning template system disorder for COPD
ATI active learning template system disorder for COPD
What is your opinion on Canada's voting system? Comment on how well (or not) the system...
What is your opinion on Canada's voting system? Comment on how well (or not) the system satisfies some of Arrow's desirable features of a voting procedure. (You don't need to comment on all 6 features - but should consider at least 2.). Please do not use the same answer.
learning template: system disorder for hip fracture. safety considerations
learning template: system disorder for hip fracture. safety considerations
Transcribe and translate the following bacterial template DNA strand TACCCCAACTACCATATACTTCAAGAAATC mRNA Sequence: Protein Primary structure:
Transcribe and translate the following bacterial template DNA strand TACCCCAACTACCATATACTTCAAGAAATC mRNA Sequence: Protein Primary structure:
Parkinson Disease- use the disorder template
Parkinson Disease- use the disorder template
Take a look at some the brands/companies that Berkshire Hathaway owns: Comment on the structure of...
Take a look at some the brands/companies that Berkshire Hathaway owns: Comment on the structure of the portfolio firm. Why is structure important and explain why it matters in this particular context.
1. Compute the capital structure of each of the following companies. Use yahoo finance, or another...
1. Compute the capital structure of each of the following companies. Use yahoo finance, or another financial site to research the financial information you need to compute capital structure. Under comments, you should say if the capital structure is good or bad based on the amount of debt and stock used to finance operations.    Company XOM WMT AAPL GM Capital Structure Comments 2. Research the weighted average cost of capital, WACC* for the following companies. Which one is the...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT