Question

Comment of the structure of another template system in use with Express.

Comment of the structure of another template system in use with Express.

Homework Answers

Answer #1

Let's take an example of using ExpressJS web framework for NodeJS.

People may use ExpressJS to put their environments like development, production or test, and also their routes etc. on the app.js. But that's not a good practice as when it comes to a large scale application, app.js then will be also too large to handle.

The following directory structure would work perfectly instead:

| my-application
| -- app.js
| -- config/
     | -- environment.js
     | -- routes.js

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
use ATI learning template System Disorder for Tuberculosis
use ATI learning template System Disorder for Tuberculosis
There is a tradeoff between capital structure and flexibility; Comment.
There is a tradeoff between capital structure and flexibility; Comment.
SYSTEM DISORDER TEMPLATE ON NEUTROPENIA PRECAUTIONS AND SARCOMAS
SYSTEM DISORDER TEMPLATE ON NEUTROPENIA PRECAUTIONS AND SARCOMAS
ATI active learning template system disorder for COPD
ATI active learning template system disorder for COPD
What is your opinion on Canada's voting system? Comment on how well (or not) the system...
What is your opinion on Canada's voting system? Comment on how well (or not) the system satisfies some of Arrow's desirable features of a voting procedure. (You don't need to comment on all 6 features - but should consider at least 2.). Please do not use the same answer.
learning template: system disorder for hip fracture. safety considerations
learning template: system disorder for hip fracture. safety considerations
Parkinson Disease- use the disorder template
Parkinson Disease- use the disorder template
Transcribe and translate the following bacterial template DNA strand TACCCCAACTACCATATACTTCAAGAAATC mRNA Sequence: Protein Primary structure:
Transcribe and translate the following bacterial template DNA strand TACCCCAACTACCATATACTTCAAGAAATC mRNA Sequence: Protein Primary structure:
Take a look at some the brands/companies that Berkshire Hathaway owns: Comment on the structure of...
Take a look at some the brands/companies that Berkshire Hathaway owns: Comment on the structure of the portfolio firm. Why is structure important and explain why it matters in this particular context.
use Ati Learning template for pulmonary Edema
use Ati Learning template for pulmonary Edema
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT
Active Questions
  • W Mart, one of major retailers, reported cash flows and earning: Comprehensive income) for the firm...
    asked 7 minutes ago
  • Parker Hi-Fi Systems Parker Hi-Fi Systems, located in Wellesley, Massachusetts, a Boston suburb, assembles and sells...
    asked 7 minutes ago
  • Manufacturing companies strive to maintain production​ consistency, but it is often difficult for outsiders to tell...
    asked 18 minutes ago
  • There is a difference between statistical probability and theoretical probability. The theoretical probability of rolling a...
    asked 25 minutes ago
  • In a small struggling technology company, the employees are aware that processes and structures must change...
    asked 37 minutes ago
  • On June 30, 2018, Blue, Inc. leased a machine from Large Leasing Corporation. The lease agreement...
    asked 47 minutes ago
  • You are on a mountain and see three other mountain tops that create a polygonal valley....
    asked 1 hour ago
  • Congressional Ethics: Identify one (1) member of Congress who has been charged with ethics violations in...
    asked 1 hour ago
  • A study had a statistically significant finding that walking 1 mile everyday will reduce the BMI...
    asked 1 hour ago
  • What is meant by electrical equivalent of heat. (define ) What is electrical energy and what...
    asked 1 hour ago
  • A block of mass 1.970  kg is free to slide on a frictionless, horizontal surface. A cord...
    asked 1 hour ago
  • A construction company purchased new equipment for $850,000. It has an estimated useful life of 15...
    asked 1 hour ago