Question

Transcribe and translate the following bacterial template DNA strand TACCCCAACTACCATATACTTCAAGAAATC mRNA Sequence: Protein Primary structure:

Transcribe and translate the following bacterial template DNA strand

TACCCCAACTACCATATACTTCAAGAAATC

mRNA Sequence:

Protein Primary structure:

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

DNA Template: 3'-TACCCCAACTACCATATACTTCAAGAAATC-5'

mRNA Sequence: 5'-AUGGGGUUGAUGGUAUAUGAAGUUCUUUAG-3'

Protein Primary Structure: 5'- Met-Gly-Leu-Met-Val-Tyr-Glu-Val-Leu-Stop-3'

Complete names of the amino acids and their codons (triplet)

  • Methionine (Met) - AUG *Start codon
  • Glycine (Gly) - GGG
  • Leucine (Leu) - UUG
  • Methionine (Met) - AUG
  • Valine (Val) - GUA
  • Tyrosine (Tyr) - UAU
  • Glutamic acid (Glu) - GAA
  • Valine (Val) - GUU
  • Leucine (Leu) - CUU
  • Stop codon - UAG
0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
The following template sequence of DNA was isolated from a bacterial cell. Identify the promoter region...
The following template sequence of DNA was isolated from a bacterial cell. Identify the promoter region (assume there is no operator) and transcribe the DNA to the right of the promoter. Once you’ve transcribed the DNA into mRNA, find the start codon and translate the sequence into the correct amino acids to create a polypeptide. 3’-AATATTTATTATATAACCCGGCATACGTTCGGACGTCCCATATAGACTCCATTCGACTT-5’
10. Given the following DNA sequence as the template strand: TTACGATGCCCA Finish the complementary DNA strand....
10. Given the following DNA sequence as the template strand: TTACGATGCCCA Finish the complementary DNA strand. AAT _ _ _ _ _ _ _ _ _ Finish the corresponding mRNA (use template strand) AAU _ _ _ _ _ _ _ _ _ Finish the corresponding protein sequence from the mRNA. (Use the table on mRNA codons to identify the protein sequence. For example, the mRNA codon AAU codes for the amino acid, asparagine, Asn. Asn-____-____-____ What would be the...
Anthropology lab. DNA structure and function The illustration below represents a portion of the DNA strand...
Anthropology lab. DNA structure and function The illustration below represents a portion of the DNA strand for production of hemoglobin’s beta chain. The strands are in the process of separating for transcription. Transcribe and translate the entire shaded portion into an mRNA strand, and using the genetic code chart (Fig. 2.20), translate it into a part of the hemoglobin protein. DNA strand   _____   _____   _____   _____   _____   _____   _____   _____   _____   _____   _____   _____   _____   _____   _____   _____   _____   _____...
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the...
A non-template DNA strand has the sequence 5’ -ACGTACAGTCCGT -3’. What is the sequence of ′′the mRNA molecule? The following sequence is located in the middle of an mRNA molecule past the first start codon, so that it is written in the correct reading frame (the first three nucleotides are the first codon, etc.) 5’ – UGC CUG ACA UGC AUC ACG UGG G – 3’. Translate this into a polypeptide (write the amino acid sequence), starting at the beginning...
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence...
A DNA template strand has the following base sequence: 5' TTACACGTGGACTGAGGACCTCTCCAT 3' 1.) What is sequence of bases that in the complimentary strand of DNA? 2.) What is the mRNA that would be transcribed from this DNA?
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation...
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation occurred. (insertion, deletion, or substitution) Identify what type of protein change resulted. (frameshift, missense, nonsense, or silent) Normal Sequence 3’ TACCTTCACCGCAGGGTAGCTTTTATTTAA 5’ Mutated sequence 3’ TACCTTCACCGCAGGTAGCTTTTATTTAA 5’
Provide the correct mRNA sequence for the following DNA sequence, and then translate this into the...
Provide the correct mRNA sequence for the following DNA sequence, and then translate this into the proper amino acid sequence for the protein the gene would encode: 5′ ATG GAA CGC CTT TAC ATC GTG TGG CAT TAT AGC CAA CGC GTT TAA 3′ Coding 3′ TAC CTT GCG GAA ATG TAG CAC ACC GTA ATA TCG GTT GCG CAA ATT 5′
3'- CCA TGT CCG GAA GTG AAT- 5' Using the same template DNA strand provided in...
3'- CCA TGT CCG GAA GTG AAT- 5' Using the same template DNA strand provided in question #1, transcribe and translate the DNA strand after the following mutations have occurred. You only need to provide the new amino acid sequence of the protein encoded after these mutations have occurred: a. A "C" to "T" base substitution at nucleotide position #8. b. A "T" to "C" base substitution at nucleotide position #6. c. Which one of these is more likely to...
3'- CCA TGT CCG GAA GTG AAT- 5' Using the same template DNA strand provided in...
3'- CCA TGT CCG GAA GTG AAT- 5' Using the same template DNA strand provided in question #1, transcribe and translate the DNA strand after the following mutations have occurred. You only need to provide the new amino acid sequence of the protein encoded after these mutations have occurred: a. A "C" to "T" base substitution at nucleotide position #8. b. A "T" to "C" base substitution at nucleotide position #6. c. Which one of these is more likely to...
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation...
Transcribe and translate the normal sequence and the mutated sequence. Identify what type of DNA mutation occurred. (insertion, deletion, or substitution) Identify what type of protein change resulted. (frameshift, missense, nonsense, or silent) normal sequence- 3' TAC GGA GCA GGG CCA AAA AAC TGT TTT ACT 5´ mutated sequence- 3´ TAC GGA GCA GGG CCA CCA AAC TGT TTT ACT 5´
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT