Question

Biology of Stem Cells. Thanks! What key transcription factor and signaling protein drives MSC osteogenesis versus...

Biology of Stem Cells. Thanks!

What key transcription factor and signaling protein drives MSC osteogenesis versus adipogenic differentiation

Homework Answers

Answer #1

Transcription factor and signaling protein drives MSC osteogenesis:

The major transcription factors are CBFA-1/Runx2 and Osterix. There are also other factors and signalling molecules involve in this process including HOXB7, CBF-1α, TNF-α, FOXC2, YAP, HOXA2, BMP9 and β-catenin, DLX5. Wnt, BMP, and Notch signaling pathways also play a crucial role. Smad, BMP9 promotes the activation of Smad1, 5, and 8 and osteogenic differentiation.

Transcription factor and signaling protein drives MSC adipogenic differentiation:

The major transcription factors are PPARγ1, PPARγ2 and EBF-1. There are also other factors and signalling molecules involve in this process including CEBPB, PRDM16, Twist-1, Dermo-1, COUP-II, Sox2 and Oct4.

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
1. What are the essential parts of a signaling pathway? 2. How could activating a transcription...
1. What are the essential parts of a signaling pathway? 2. How could activating a transcription factor cause long-term cellular changes? 3. What roles can phosphorylation play in protein function? 4. What is the enzymatic activity of a kinase and of a phosphatase?
1. what is the major function of the maturaton-promoting factor? -promoting DNA duplication - monitoring the...
1. what is the major function of the maturaton-promoting factor? -promoting DNA duplication - monitoring the G1-S checkpoint - promoting cell differentiation - facilitating cell growth in G1 - promoting cells to enter M phase 2. the best description of totipotent stem cells? - present in the adult brain to produce new nerve cells to facilitate learning and memory - the yare embryonic stem cells capable of generating every type of cells in the body - they can produce both...
Remember: Crx is a key retinal transcription factor. Crx binds regulatory elements called CBRs (Crx-binding regions)....
Remember: Crx is a key retinal transcription factor. Crx binds regulatory elements called CBRs (Crx-binding regions). You use the DNA sequences from the patients to create plasmids for a luciferase assay. In a luciferase assay you add your promoter and any regulatory regions of interest to a vector containing the gene for luciferase. You then transform bacteria with the vector (you make bacteria take up the vector). The transcription of luciferase is controlled by the promoter/regulatory region you added to...
24. TBP is a protein subunit of the general transcription factor TFIID. What is the term...
24. TBP is a protein subunit of the general transcription factor TFIID. What is the term (acronym) used to name the other protein subunits found in TFIID? 25. The sequence below represents a 5’ region of a particular mRNA (assume that the t’s are u’s), containing a portion of the 5’UTR and the ORF: 5’…gacggactgttctatgactgcaaagatggaa… Taking into account the function of the start codon, what would by the amino acid sequence produced from the above portion of mRNA? 26. The...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT