Question

24. TBP is a protein subunit of the general transcription factor TFIID. What is the term...

24. TBP is a protein subunit of the general transcription factor TFIID. What is the term (acronym) used to name the other protein subunits found in TFIID?

25. The sequence below represents a 5’ region of a particular mRNA (assume that the t’s are u’s), containing a portion of the 5’UTR and the ORF:

5’…gacggactgttctatgactgcaaagatggaa…

Taking into account the function of the start codon, what would by the amino acid sequence produced from the above portion of mRNA?

26. The sequence below represents a 3’ region of the same mRNA as above (assume that the t’s are u’s), containing an in frameportion of the ORF and the 3’UTR:

5’…cagttgcaaacattttgaagagagaccgt

Taking into account the function of stop codons, what would by the amino acid sequence produced from the above portion of mRNA?

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

24. TAFs (TBP associated factors) are the other protein subunits of the TFIID complex which are about 12 in number.

25. By substituting T's for U's, the sequence can be written as

5'...GACGGACUGUUCUAUGACUGCAAAGAUGGAA..

The first intiation codon AUG encountered is shown in bold letters and intiation will start with Met aminoacid

The aminoacid sequence will be as Met-Thr-Ala-Lys-Met-Glu...

26. Again by substituting T's for U's, we can write the sequence as

...CAGUUGCAAACAUUUUGAAGAGAGACCGT

The stop codon in the sequence is UGA which is shown in bold letters.

The aminoacid sequence will be as ...Gln-Leu-Gln-Thr-Phe

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
Q2 An open reading frame (ORF) is a section of codons that begins with a start...
Q2 An open reading frame (ORF) is a section of codons that begins with a start codon and ends with a stop codon. Each codon specifies for a specific amino acid. ORF is the part of a gene that after transcription into an mRNA gets translated into a protein. With the help of several translation factors and enzymes, ribosomes translate mRNAs into proteins. The following DNA sequence contains a complete open reading frame (ORF) of a short transcriptional unit. The...
ANSWER KEY Recombinant DNA Anticodon Mutation Uracil Codon Replication tRNA Thymine Antiparallel Translation Transcription Polymerase Chain...
ANSWER KEY Recombinant DNA Anticodon Mutation Uracil Codon Replication tRNA Thymine Antiparallel Translation Transcription Polymerase Chain Reaction Match the correct answer with the corresponding statement. A base found in RNA but not DNA A base found in DNA but not RNA The opposite directions run by two strands of DNA double helix Protein synthesis When mRNA is synthesized from DNA When a strand of DNA makes a new copy prior to cell division The RNA that carries amino acids to...
Introns are known to contain stop codons (UAA, UGA, or UAG), yet these codons do not...
Introns are known to contain stop codons (UAA, UGA, or UAG), yet these codons do not interrupt the coding of a particular protein. Why? a. More than one stop codon is needed to stop transcription. b. Exons are spliced out of mRNA before translation. c. These triplets do not cause termination in gene expression. d. Stop codons are only required for termination of mRNA synthesis. e. Introns are removed from mRNA before translation A(n) _____ is located upstream of a...
Write the mRNA that would form for the following section of DNA. For each codon in...
Write the mRNA that would form for the following section of DNA. For each codon in the mRNA, write the amino acid that would be placed in the protein by a tRNA. 3.1. DNA strand: 3’—CCC—TCA—GGG—CGC—5’ mRNA: —______—______—______—______— amino acid order _______—_______—_______—_______ 3.2. DNA: 3’—ATA—GCC—TTT—GGC—AAC—5’ mRNA: —______—______—______—______—______— amino acid order —_______—_______—_______—_______—_______ • If a base substitution in DNA ( G replaces C in DNA ) ,changes the second codon in mRNA, how is the amino acid sequence affected in the...
Transcription is the process of RNA synthesis.  Translation is the cytoplasmic process of protein synthesis.  Both processes can...
Transcription is the process of RNA synthesis.  Translation is the cytoplasmic process of protein synthesis.  Both processes can be divided into three stages, Initiation, Elongation, and Termination.  For each of the events listed below write which process it occurs in (either transcription or translation) and in which stage the event occurs (initiation, elongation, termination). e. The transfer RNA bringing the new amino acid to be incorporated binds in the amino acyl site.             f. The terminator sequence in the messenger RNA is cleaved and...
1.What are the building blocks of nucleic acids? 2.What are the 3 components of these building...
1.What are the building blocks of nucleic acids? 2.What are the 3 components of these building blocks ? 3.How is RNA different from DNA? Give three specific reasons. a._______________________________________________ b._______________________________________________ c._______________________________________________ 4.What are the three types of RNA found in a cell, what is the function of each and are these translated? RNA Function Translated? a. b. c. 5.What is a codon? a. Anticodon? Each of the following questions asks you to work out a sequence of nucleotide bases. When...
QUESTION 21 Which molecule or enzyme mediates the process of Transcription? a. RNA Polymerase b. RIbosomes...
QUESTION 21 Which molecule or enzyme mediates the process of Transcription? a. RNA Polymerase b. RIbosomes c. Primase d. DNA Polymerase e. ribosomal RNA QUESTION 22 Which site of the tRNA molecule binds to the mRNA molecule? a. Poly-A tail b. anti-codon c. codon d. exon e. intron QUESTION 23 Which of the following accurately describes the Central Dogma? a. RNA to Protein to DNA b. DNA to Protein to RNA c. DNA to RNA to Protein d. Protein to...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA template strand Use the information above to answer the following questions. Write the sequences of the two double-stranded daughter DNAs which will be replicated from the sequence above. Indicate which sequences are directly from the parent. Show accurate direction of each sequence. 0.5 points Write the sequence of the mRNA strand that will be transcribed from the above DNA sequence. Show accurate direction of...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA template strand Use the information above to answer the following questions. Write the sequences of the two double-stranded daughter DNAs which will be replicated from the sequence above. Indicate which sequences are directly from the parent. Show accurate direction of each sequence. 0.5 points Write the sequence of the mRNA strand that will be transcribed from the above DNA sequence. Show accurate direction of...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA...
5’…TAC ACC GAT GGA TAA GTC…3’ DNA Coding strand 3’…ATG TGG CTA CCT ATT CAG…5’ DNA template strand Use the information above to answer the following questions. Write the sequences of the two double-stranded daughter DNAs which will be replicated from the sequence above. Indicate which sequences are directly from the parent. Show accurate direction of each sequence. 0.5 points Write the sequence of the mRNA strand that will be transcribed from the above DNA sequence. Show accurate direction of...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT