Question

15. In the given sequence, aaccggtaaacaagtccccaaacccactagtccctttgaaaaaggg The gene you are interested has one palindromic site for...

15. In the given sequence, aaccggtaaacaagtccccaaacccactagtccctttgaaaaaggg The gene you are interested has one palindromic site for restriction enzyme X and another site for enzyme Q, the distance between these two motifs are how many nucleotides?

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

Answer) 18 nucleotides

Explanation- A palindromic sequence is a nucleic acid sequence in a double stranded DNA or RNA wherein reading in a certain direction (for example: 5' to 3') on one strand matches the sequence reading in the same direction (that is 5' to 3') on the complementary strand.

So, to solve this problem first write the complementary sequence of this given strand and find out the palindromic sequences present in it.

- AACCGGTAAACAAGTCCCCAAACCCACTAGTCCCTTTGAAAAAGGG-

- TTGGCCATTTGTTCAGGGGTTTGGGTGATCAGGGAAACTTTTTCCC-

The sequences in brown color (ACCGGT) and green color (ACTAGT) are 2 palindromic sequences found in it. And the distance between these two motifs are 18 nucleotides (marked in dark black letters)

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
Genetic/Biology question- Restriction Mapping and Creating and Designing Recombinant DNA. I have a human DNA sequence...
Genetic/Biology question- Restriction Mapping and Creating and Designing Recombinant DNA. I have a human DNA sequence consisting of 868 bp, of which 3 specific restriction enzymes made cuts. I was then given a plasmid DNA sequence of 2220 bp and I'm asked to ligate the DNA into a plasmid DNA vector. The plasmid DNA sequence also had one of the same restriction enzymes as the human sequence... ex: the cut is made on the human sequence at bp 101, and...
A.) Which sequence, genomic or cDNA, would you use to clone into an expression vector in...
A.) Which sequence, genomic or cDNA, would you use to clone into an expression vector in order to produce a human protein in an E.coli host? Explain why (one sentence should do it).     B.)The C. botulinum (the bacteria causing botulism) genome is 30% G/C base pairs. What is the average distance between BamHI restriction enzyme sites in the genome? BamHI recognition site is:    G G A T C C C C T A G G                                                                                                                        
If the divergence in nucleotide sequence for a particular gene (10,000 nucleotides) between two related living...
If the divergence in nucleotide sequence for a particular gene (10,000 nucleotides) between two related living taxa is 300 mutations and the oldest fossil of either lineage occurred 15 Mya, what is the rate of divergence per base pair per million years? One version of the equation is D=2rt, convert this as needed to answer the question. For full credit, you must show your work, include a definition of each variable in the equation, and use the correct time unit...
16. You digested a linear DNA fragment with a RE and the fragment has three recognition...
16. You digested a linear DNA fragment with a RE and the fragment has three recognition sites for the RE. How many fragments of DNA will be produced? A. three                B. four C. five D. six                     17. The RE HhaI cuts the recognition site 5’GCGC3’. The probability of having a cutting site for this enzyme is about one in every __________bp of genomic DNA. A. 100 B. 250                C....
If you do a PCR reaction with DNA from a person who is heterozygous for a...
If you do a PCR reaction with DNA from a person who is heterozygous for a SNP in the gene you are amplifying and you have a restriction enzyme that will recognize and cut only the one of the two allleles, how many bands will you see if you run the restriction digest out on an agarose gel?
In hounds, one enzyme is needed to produce a substance required for smell. Gene S produces...
In hounds, one enzyme is needed to produce a substance required for smell. Gene S produces this enzyme. Another enzyme is needed to produce another substance required for smell (produced by gene R). These two genes are not linked. Individuals homozygous for either one or both of the nonfunctional recessive alleles, s or r, are incapable of smelling. i) What are the expected proportions for phenotypes in a dihybrid cross for two unlinked genes controlling two traits (the simple Mendelian...
You are interested in sex determination. A. If a patient had a mutation in a gene...
You are interested in sex determination. A. If a patient had a mutation in a gene that was active in late testes differentiation, would the patient show as male or female? What phenotypes would the patient show? B. Two male patients show up in a fertility clinic. Their genomes were examined. One was found to be XX, sry+, while the second patient was found to be XX, sry-. In ONE sentence, explain how the two men could be XX. Would...
Why are type II endonucleases, instead of types I and III, preferably used in molecular biology?...
Why are type II endonucleases, instead of types I and III, preferably used in molecular biology? A. Endonucleases I and III use ATP and cut away from their recognition sites, but an endonuclease II enzyme does not use ATP and cuts within the recognition sequence B. Endonucleases I and III cut at only a few DNA sequences, whereas endonuclease II enzymes cut at a very large number of recognition sequences C. Endonucleases I and III are large, which causes highly...
12. You have a short piece of DNA. One strand has the following sequence: 5’ AGCTACTCCTAA...
12. You have a short piece of DNA. One strand has the following sequence: 5’ AGCTACTCCTAA 3’. a. Please write down sequence of the other strand, starting with the 5’ end. (0.2 pt) b. If these two strand wind together as a B form DNA, how long do you expect this DNA to be? (0.2 pt) c. How many hydrogen bonds are there to stabilize the structure of this DNA? (0.2 pt) d. Besides hydrogen bonds, what other forces stabilize...
PLEASE EXPLAIN YOUR ANSWER COMPLETLY AND CORRECTLY. THANK YOU! Consider a yeast cell which wants to...
PLEASE EXPLAIN YOUR ANSWER COMPLETLY AND CORRECTLY. THANK YOU! Consider a yeast cell which wants to express a 900 bp gene. Assuming this gene has no introns, ignoring any 5’ or 3’ untranslated regions, and assuming a 100 bp poly-A tail, how many nucleotides are required to transcribe this gene? For simplicity’s sake, let’s assume all the nucleotides are ATP. Based on what you know about translation, how many ATPs (or GTPs) would required to translate this protein? Given the...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT