Question

1. Suppose you use the forward primer 5' AATGAAA 3' and the reverse primer 5' ATCAGGG...

1. Suppose you use the forward primer 5' AATGAAA 3' and the reverse primer 5' ATCAGGG 3' to amplify the double-stranded DNA fragment 5' ATGAAATTTGGGCCCTGA 3'. What will be the sequence of the most abundant amplicon in the PCR after 40 cycles?

2. Suppose you use the forward primer 5' TGAAA 3' and the reverse primer 5' CAGGG 3' to amplify the double-stranded DNA fragment 5' ATGAAATTTGGGCCCTGA 3'. What will be the sequence of the most abundant amplicon in the PCR after 40 cyles?

3. Suppose you use the forward primer 5' ATCAAA 3' and the reverse primer 5' TCCGGG 3' to amplify the double-stranded DNA fragment 5' ATGAAATTTGGGCCCTGA 3'. What will be the sequence of the most abundant amplicon in the PCR after 40 cycles?

Science   Biology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

1) the forward primer is complementary to the region given in yellow and the reverse primer is complementary to the region given in green

5' ATGAAATTTGGGCCCTGA 3'.

3`-TACTTTAAACCCGGGACT-5`

but the primer has an overhang, that an A nucleotide is extra at the 5` end of the primers

so the amplified DNA will be 2 basepairs longer than the basepairs in the template DNA.

length of amplified DNA= number of basepairs in the template DNA + 2

= 18+2

= 20

length of amplified DNA = 20 bp

0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
PCR Questions What gives DNA strands its polarity? To answer, tell me what the “ 5’...
PCR Questions What gives DNA strands its polarity? To answer, tell me what the “ 5’ ” and “ 3’ ” ends are referring to in chemical terms.   Diagram a “template” and the primers for a PCR reaction, including the 5’ and 3’ notations as appropriate. Will the “forward” primer have the same sequence as the coding strand or complement strand? Will the “reverse” primer have the same sequence as the coding strand or complement strand? After running PCR, a...
Fragment of double-stranded DNA: 5' TGGCAGTCGATGCTGCTAGCTGGCCTTGAGTCGTGC 3' Which primer could amplify the whole fragment of the...
Fragment of double-stranded DNA: 5' TGGCAGTCGATGCTGCTAGCTGGCCTTGAGTCGTGC 3' Which primer could amplify the whole fragment of the following? a) 5’ GACTGCCA 3’ & 5’ GCACGACT 3’ b) 5’ GACTGCCA 3’ & 5’ AGTCGTGC 3’ c) 5’ TGGCAGTC 3’ & 5’ GCACGACT 3’ d) 5’ TGGCAGTC 3’ & 5’ AGTCGTGC 3’ e) 5’ TGGCAGTC 3’ & 5’ CGTGCTGA 3’
Here is the nucleotide sequence of one strand of a fragment of double-stranded DNA, which will...
Here is the nucleotide sequence of one strand of a fragment of double-stranded DNA, which will be amplified by PCR using short primers:      5' TGGCAGTCGATGCTGCTAGCTGGCCTTGAGTCGTGC 3'      Primers that could be used to amplify this entire DNA fragment are: A) 5’ GACTGCCA 3’ & 5’ GCACGACT 3’ B) 5’ GACTGCCA 3’ & 5’ AGTCGTGC 3’ C) 5’ TGGCAGTC 3’ & 5’ GCACGACT 3’ D) 5’ TGGCAGTC 3’ & 5’ AGTCGTGC 3’ E) 5’ TGGCAGTC 3’ & 5’ CGTGCTGA 3’
The forward and reverse primers for PCR amplification have the following sequences: Forward: 5'-CTATGAGTTACTCACATG-3', Reverse: 5'-...
The forward and reverse primers for PCR amplification have the following sequences: Forward: 5'-CTATGAGTTACTCACATG-3', Reverse: 5'- GAAAGCATCCAGGCCCGG-3'. Based on the manually calculated melting temperatures, would you recommend using these primers together? Why or why not?
1. What would happen to the white blood cells if they were extracted in anything other...
1. What would happen to the white blood cells if they were extracted in anything other than isotonic conditions? Describe what would happen to the cheek cells in hypertonic and hypotonic solutions respectively. 2. The polymerase chain reaction can only be used to amplify genes that have already been cloned and sequenced. Why is this true? 3. If you started a PCR protocol with 10 double-stranded molecules of DNA, how many double-stranded molecules of the product would you have after...
Procedure I. Reverse Transcription. For each of your RNA samples set up the following reaction: *Remember...
Procedure I. Reverse Transcription. For each of your RNA samples set up the following reaction: *Remember to use proper RNA handling technique! 1. In a 0.2 ml size RNAse-Free tube add the following: • 0.5 µg RNA (no more than 6 µl) You can add as little as 0.1 µg of RNA if your concentration is low • 2 µl dT primer • Nuclease Free Water to final volume of 8 µl * Before you start write the exact volume...
You use the Sanger sequencing protocol to sequence the following DNA fragment: 5’-TGCACGGGTCAGCT-(primer site)-3’ Draw a...
You use the Sanger sequencing protocol to sequence the following DNA fragment: 5’-TGCACGGGTCAGCT-(primer site)-3’ Draw a picture of the resulting sequencing gel, with products ending in each of the four dideoxynucleotides (ddATP, ddTTP, ddCTP, and ddGTP) in separate lanes of the gel. Be sure to label each lane as ddATP, ddTTP, ddCTP, or ddGTP.
A Drosophila gene produces an mRNA that begins with the following base sequence, 5’CAGUCUCCGACGU..... and ends...
A Drosophila gene produces an mRNA that begins with the following base sequence, 5’CAGUCUCCGACGU..... and ends in a poly-A tail. A full-length cDNA copy of this mRNA can be made and amplified by using one primer and the appropriate enzyme to make a first strand cDNA, then adding a second primer and another enzyme to make and amplify double-stranded DNA in a polymerase chain reaction. Which primers and enzymes should be used first and second? First primer First enzyme Second...
You have a sample of ssDNA molecule that you will use as a primer for PCR....
You have a sample of ssDNA molecule that you will use as a primer for PCR. You dissolved the dried ssDNA peller in TE to a total volume of 400 ul to make a "stock DNA sample." You need to determine the concentration (ug/ul) of this primer DNA in solution. To do this you took 4 ul from the "stock DNA sample" and added these to 996 ul of TE buffer in a cuvette, making a total of 1000 ul...
which 10-bp primer can be used to amplify the following DNA sequence? 5'-GTCATTGCCTAGCCTAAGCTAAAGCTA-3' which of the...
which 10-bp primer can be used to amplify the following DNA sequence? 5'-GTCATTGCCTAGCCTAAGCTAAAGCTA-3' which of the following amino acids yield TCA cycle intermediates when deaminated? Aspartate and Alanine Glutamate and Asparate Alanine and Glutamate Arginine and Aspartate Glutamate and Arginine
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT