Question

The function of RNA IS ?

The function of RNA IS ?

Science   Anatomy-And-Physiology   
0 0
Add a commentTranscribed image text
Next >

Homework Answers

Answer #1

Types of RNA :-

  • Transfer RNA (tRNA)
  • Ribosomal RNA (rRNA)
  • Messenger RNA (mRNA)

Functions of Different RNA :-

1. mRNA :-

  • It transcribes genetic information of DNA ( Gene ) for protein synthesis from the Nucleus to ribosome in the form of genetic code .

2. tRNA :-

  • The tRNA is act as adapter molecule . It carries amino acid which are added to the polypeptide chain (protein ) at the ribosome during translation .

3. rRNA :-

  • rRNA makes up the ribosomes with proteins , the sites of protein synthesis in the cytoplasm .
  • ​​​​​​​It is involved in the process of translating the mRNA or genetic messages into a protein.
0 0
Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
Discuss the process of transcription of bacteria; what is the function of the RNA polymerase holoenzyme...
Discuss the process of transcription of bacteria; what is the function of the RNA polymerase holoenzyme in this process?
Which of these describes the function of RNA polymerase? A.    amplifies the “message” by making multiple...
Which of these describes the function of RNA polymerase? A.    amplifies the “message” by making multiple copies of an mRNA molecule after it has been transcribed from DNA B.    converts a protein sequence to mRNA C.    transcribes DNA to mRNA D.    translates DNA into protein
Which biological function is not controlled by antisense RNA? A. iron metabolism in bacteria B. the...
Which biological function is not controlled by antisense RNA? A. iron metabolism in bacteria B. the circadian rhythm in neurospora C. replication of prokaryotic genomic DNA D. replication of ColE1 plasmid E. developmental control of basic fibroblast growth factor
A toxin found in a recently discovered mushroom interrupts the function of a human’s snRNP RNA...
A toxin found in a recently discovered mushroom interrupts the function of a human’s snRNP RNA known as U2. Answer the two questions below. a. What specific U2 functions are disrupted? (2 points) b. What complex would this ultimately terminate the assembly of?
Explain how riboswitches function. (6) 6.2 Indicate if you think the RNA sequence below could be...
Explain how riboswitches function. (6) 6.2 Indicate if you think the RNA sequence below could be part of a riboswitch mechanism and explain why. Strand 1: AUGCCAUAGCUUCGAUGGGCAUCGAAGCUAUGGCGAGAUUUCGAAGCUA
Which statement is correct about RNA & hybridization during transcription? a. RNA does not hybridize to...
Which statement is correct about RNA & hybridization during transcription? a. RNA does not hybridize to DNA or to itself b. RNA hybridizes to both DNA & itself c. RNA does not hybridize to DNA, but hybridizes to itself d. RNA hybridizes to DNA, but not to itself e. RNA hybridizes to DNA, itself, & proteins at different times
Q. which is false about RNA? a) RNA is composed of ACG and U building blocks...
Q. which is false about RNA? a) RNA is composed of ACG and U building blocks b) RNA can form stable double stranded structures c) The building blocks of RNA are connected via 2' to 5' phosphodiester bonds d) RNA is sensitive to hydrolysis in basic conditions e) The building blocks of RNA contain ribose
4. Which statement describes the central dogma of biology? a) DNA is transcribed into RNA. RNA...
4. Which statement describes the central dogma of biology? a) DNA is transcribed into RNA. RNA is translated into an amino acid sequence. b) Translation is the process of synthesizing RNA from DNA. Transcription is the process of synthesizing an amino acid sequence from RNA. c) Transcription is the process of synthesizing DNA from RNA. Translation is the process of synthesizing an amino sequence from DNA. d) DNA is transcribed to an amino acid sequence. RNA is translated to an...
Which of the following statements about eukaryotic RNA is correct? A. Eukaryotic RNA is capped at...
Which of the following statements about eukaryotic RNA is correct? A. Eukaryotic RNA is capped at its 3' end. B. Eukaryote transcript splicing allows for subtle regulation of gene activity. C. A primary eukaryotic transcript can only encode for one protein. D. Processing of the RNA can only occur after termination. E. Eukaryotic RNA is polyadenylated at its 5' end.
Define them a)promoter. b)primer. c)Genomic Rna/Virion Rna. d)Antigenomic RNA/Subgenomic Rna.e)ORF.f)RF/RI.f)super group
Define them a)promoter. b)primer. c)Genomic Rna/Virion Rna. d)Antigenomic RNA/Subgenomic Rna.e)ORF.f)RF/RI.f)super group
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT