Question

4. Which statement describes the central dogma of biology? a) DNA is transcribed into RNA. RNA...

4. Which statement describes the central dogma of biology?

a) DNA is transcribed into RNA. RNA is translated into an amino acid sequence.

b) Translation is the process of synthesizing RNA from DNA. Transcription is the process of synthesizing an amino acid sequence from RNA.

c) Transcription is the process of synthesizing DNA from RNA. Translation is the process of synthesizing an amino sequence from DNA.

d) DNA is transcribed to an amino acid sequence. RNA is translated to an amino acid sequence.

Homework Answers

Answer #1

Ans

A

Central dogma of molecular biology is defined as conversion of DNA into RNA and RNA into amino acid ( protein ).

Conversion of DNA into RNA is called transcription.

Conversion of RNA into amino acid is called translation.

I have re evaluated the question and answer both .

The process of synthesis of RNA from DNA is transcription rather than translation.

The translation is synthesis of protein from RNA.

It is defined under central dogma of molecular biology ..

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
SARS-CoV-2 is said to violate the Central Dogma of Biology because it... A. Possesses both a...
SARS-CoV-2 is said to violate the Central Dogma of Biology because it... A. Possesses both a DNA and an RNA genome B. Regulates gene expression at the level of RNA processing, which is otherwise characteristic only of eukaryotic organisms C. Uses RNA as a template to transcribe DNA, which is translated into a polypeptide D. Translates the original infecting SARS-CoV-2 RNA to make RNA-dependent RNA polymerase, which allows for generation of complete copies of genomic RNA and, ultimately, other viral...
riefly discuss the central dogma in sufficient detail as it relates to eukaryotes. Some terms that...
riefly discuss the central dogma in sufficient detail as it relates to eukaryotes. Some terms that may be useful in your discussion are: DNA, mRNA, protein, intron, exon, 5' cap, poly-A tail, ribosome, tRNA, rRNA, transcription, translation, amino acid, RNA polymerase, nucleus, cytoplasm.
12. The DNA remains in the nucleus when RNA is made. The process is properly known...
12. The DNA remains in the nucleus when RNA is made. The process is properly known as: A. Transcription B. Translation C. Conversation 15. A mutation in the DNA _________ results in a mistake in the amino acid sequence in the protein being built. A. Sometimes B. Never
QUESTION 21 Which molecule or enzyme mediates the process of Transcription? a. RNA Polymerase b. RIbosomes...
QUESTION 21 Which molecule or enzyme mediates the process of Transcription? a. RNA Polymerase b. RIbosomes c. Primase d. DNA Polymerase e. ribosomal RNA QUESTION 22 Which site of the tRNA molecule binds to the mRNA molecule? a. Poly-A tail b. anti-codon c. codon d. exon e. intron QUESTION 23 Which of the following accurately describes the Central Dogma? a. RNA to Protein to DNA b. DNA to Protein to RNA c. DNA to RNA to Protein d. Protein to...
1. As the RNA polymerase is synthesizing new RNA, it uses one strand of the DNA...
1. As the RNA polymerase is synthesizing new RNA, it uses one strand of the DNA as a template and it adds a new nucleotide to which end of the growing RNA strand? As it moves along the DNA template, which direction is the polymerase moving? 2. In eukaryotes, the genomic DNA is packaged with proteins called histones. What is the term for the combination of DNA + histones? 3. In eukaryotes, when the initial RNA is transcribed, is it...
Which of these describes the function of RNA polymerase? A.    amplifies the “message” by making multiple...
Which of these describes the function of RNA polymerase? A.    amplifies the “message” by making multiple copies of an mRNA molecule after it has been transcribed from DNA B.    converts a protein sequence to mRNA C.    transcribes DNA to mRNA D.    translates DNA into protein
The three forms of RNA differ in that a)rRNA is not transcribed from DNA b) all...
The three forms of RNA differ in that a)rRNA is not transcribed from DNA b) all tRNAs are identical c) only mRNA is translated d) both rRNA and tRNA are structural components of ribosomes, but mRNA is not
(2) Below is the entire transcribed RNA sequence of a prokaryotic gene. 5 GCAUAGCAAAUGAGCAUCAUGUGUCAAUGAGGCGAUG 3 (a)...
(2) Below is the entire transcribed RNA sequence of a prokaryotic gene. 5 GCAUAGCAAAUGAGCAUCAUGUGUCAAUGAGGCGAUG 3 (a) Find the protein-coding sequence and provide the amino acid sequence of the encoded protein (b) Which amino acid is at the C-terminus of this peptide?
13) In transcription, a new strand of RNA is created as bases are added by which...
13) In transcription, a new strand of RNA is created as bases are added by which enzyme? A. Bacterial duplicating complex        B. DNA polymerase C. DNA replicase                D. RNA polymerase 14) Which of the following molecules is most responsible for converting the nucleic acid language into the amino acid language?         A. DNA            B. mRNA        C. tRNA            D. rRNA 15) Which of the following statements best describes prokaryotes and eukaryotes?...
ANSWER KEY Recombinant DNA Anticodon Mutation Uracil Codon Replication tRNA Thymine Antiparallel Translation Transcription Polymerase Chain...
ANSWER KEY Recombinant DNA Anticodon Mutation Uracil Codon Replication tRNA Thymine Antiparallel Translation Transcription Polymerase Chain Reaction Match the correct answer with the corresponding statement. A base found in RNA but not DNA A base found in DNA but not RNA The opposite directions run by two strands of DNA double helix Protein synthesis When mRNA is synthesized from DNA When a strand of DNA makes a new copy prior to cell division The RNA that carries amino acids to...
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT