step by step using python
According to Wikipedia, "In genetics, a sequence motif is a nucleotide or amino-acid sequence pattern that is widespread and has, or is conjectured to have a biological significance." A very simple motif might be a fixed stretch of DNA, e.g., ATCGATC. Write a program that will ask for two inputs: (1) a DNA sequence, and (2) a motif, and have the program report all of the positions (indices) within the sequence where the motif is found. The positions should all be reported on one line, separated by commas.
Example:
Input sequence: CCATCGATCGATCTCGATTCGATCGATCCCTGCG
Motif: ATCGATC
Motif found at positions: 2, 6, 21
Look at my code and in case of indentation issues check the screenshots.
----------------main.py---------------
def main():
dna_sequence = input("Input sequence: ")
#get input DNA sequence from user
motif = input("Motif: ")
#get motif input from user
motif_positions = []
#list to store motif positions
i = 0
#start index from 0, search
motif at every index
while i < len(dna_sequence):
#loop
until we reach end of the dna_sequence
if dna_sequence[i : i+len(motif)]
== motif: #slice the dna_sequence at
the ith index, and check if it is matching motif
motif_positions.append(i)
#if it
matches, then add i to the motif_positions
i = i+1
#move to next index
print("Motif found at positions: ", end = "")
for pos in motif_positions:
#print all the motif positions separated by
commas
print(str(pos), end = ", ")
print()
main()
----------Screenshots--------------
----------Output--------------
----------------------------------------------
Do comment if you need any clarification.
Please let me know if you are facing any issues.
Please Rate the answer if it helped.
Thankyou
Get Answers For Free
Most questions answered within 1 hours.