Question

g) You become highly ambitious at work and unfortunately you contaminate the E. palapyensis with E....

g) You become highly ambitious at work and unfortunately you contaminate the E. palapyensis with E. gaboronensis. Because you have worked with the strains for long enough, you know that the two strains differ in a few bases on the promoter sequence as below: E. gaboronensis: CAGATACCATGGCTAAAAAGAAAATTCTGGCCGATTTTAGTCGT TGAAGAGCTTGCATGCATGCATGCATGCATGAATTC E. palapyensis: CAGATACCATGGCTAAAAAGAAAATTCTGGCCGATTTTAGTCGTTGA AAGCTTTGCATGCATGCATGCATGCATGAATTC

i) After progressively showing how important you are to the company, your advisor suggests that you compare the levels of expression of the protein in both strains. i. How would you purify Lys mRNA transcripts from the two strains

Homework Answers

Answer #1

The purification of Lys mRNA transcripts from the two strains can be done my lysine residue methylation. Methyl transferase is one enzyme that can transfer methyl groups to the gene or location being targetted. Eukaryotic elongation factor 1 alpha (eif1a) is one target for the methylation of lysine residue on mRNA transcripts by this enzyme. The human methyltransferase called METTL21B specifically targets Lys-165 of eIF1A. The methyl residies can be tagged with green fluorescent proteins and the mRNA transcripts can be identified from the two strains by identifying the cells that has methylated lysine residues on eIF1a.

Reference:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5416902/

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions