JustAAA
Home
Questions
Share
Post a Question (with Answer)
Coins
Ask a Question
Log In
Sign Up
Home
/
Biology Questions
Search
Biology Questions
Proteins and other molecules are often transported among: a.cellular compartments. b. regions within the nucleus. c.cellular...
The lining of the small intestine is covered with _____, tiny, finger-like structures that absorb nutrients...
compare and contrast fetal development and embryonic development in human pregnancy
Atoms that are most stable have only one electron in their valence shell. true or false
Aegyptopithecus is classified as a Catarrhine. What two specific traits support this classification?
Reproductive isolation can take the form of the following with the exception: Group of answer choices...
1. Which of the following can be found outside of a cell's membrane? (Choose ALL correct...
A man with hemophilia (a recessive, sex-linked condition) and a woman that carries the hemophilia allele...
How to understand which type of restriction enzymes to use in an experiment and what will...
The Warburg Effect refers to the observation that: a. Broken tumour cells can carry out glycolysis...
A molecule of octane contains about six times the mass of a molecule of water. Nevertheless,...
Indicate one specific, beneficial use of fungi for humans
8. Consider a neuron whose resting potential is -60 mV, and the EK = -100 mV...
Please answer all 3 no need to go in Depth The cytoplasm of an unfertilized egg...
Multiple Choice Please answer all 3 no need to go in Depth Which of the following...
57) Enzymes function by reducing the energy of activation of a chemical reaction so that the...
protein use in the body
Which statement is a prediction of the multifactorial threshold liability model? a) An individual's risk is...
1. A doctor writes an order for a patient to receive a medicine at 10 mg/kg...
Which version of the polio vaccine is given today in areas where the polio virus still...
Task #1: Respiration Rate Changes in Minnows as a Function of External Temperature (adapted from exercise...
What is the purpose of wiping down your work area with bleach before and after an...
44) Which events in cellular respiration produce the most ATP? 45) Cell cytoplasm is primarily composed...
If the broad-sense heritability of a trait is .62, what proportion of the observed phenotypic variance...
list the three groups of algae, both scientific and common name, give a specific example of...
if sarah and bill have 3 XX children what is the chance genetically that their next...
What happens to the rate of the citric acid cycle in the presence of a respiratory...
describe what uncouplers do to the P/O ratio in an actively respiring mitochondrion.
Summarize what is meant by a respiratory uncoupler. What do these compounds “uncouple”?
Describe in words why protons crossing the inner mitochondrial membrane can power the synthesis of ATP,...
Predict what would happen to the concentrations of each of the following compounds (increase, decrease, no...
Bioengineers construct peptides with new functions by starting with a particular peptide, and then mutating the...
cyanide ion (CN-) inhibits the electron transport chain. Cyanide (though deadly) does not lead to production...
You are studying the Hox genes in a new animal model system. How would you determine...
21) Which is false regarding sexually transmitted diseases (STD's)? A. Since STD pathogens are susceptible to...
If the total biomass of a producer in an ecosystem is 1000 tons, what would the...
5) Which of the following is not applicable to Listeria monocytogenes, or to the disease it...
The main features of fish. How can fish be described according to examples of representative species, basic...
Which of these molecules would provide the most energy (kcal/g) when eaten? protein, glycogen, starch or...
Describe the formation of the primordial cell, in detail. What is the difference of formation of...
The main features of fish. How can fish be described according to examples of representative species, basic...
Why do most researchers believe Homo floresiensis had such a small cranium?
(1.) On the protein alignment, what do the asterisk (*) symbols represent? A. The general property...
7. Serological testing for COVID-19 involves acquiring a patient blood sample via finger prick. a. What...
Describe, in general terms, the two main stages of photosynthesis.
Distinguish between autotrophic and heterotrophic nutrition.
How different are the swimming strategies used by osteichthyes and chondrichthyes? Why do sharks need to...
Explain the evolutionary significance of glycolysis.
when is aquatic surface resperation used, and why is it an advantagous behavior??
a tecnologist performs a manual wbc count using the leuk -o-tic system and the following results...
Fill in the blanks with appropriate terms from the list below: carbon dioxide oxygen sugar sunlight...
Around 2005 it was reported in several scientific journals that toads were spontaneously exploding in a...
Which statement about DNA is FALSE? a. Nucleosides are the monomeric units of DNA. &
identify some of the differences Characteristic,Water-soluble vitamins,Fat-soluble vitamins. Contained in what type of foods? How are...
Which of the following is most likely to be the result of a mutation in the...
What is the purpose of an uninoculated control tube in a differential test? Should this tube...
How different are the swimming strategies used by osteichthyes and chondrichthyes? Why do sharks need to...
what imoves the human egg through the oviduct? a the beating of the egg's cilia b.Rhythimc...
Which of the following functions of DNA is necessary for evolution to occur? A.Translation B. Transcription...
1. Photosynthesis consists of which two set of reactions that are linked by redox reactions to...
Which of the following population would be affected most by a density-dependent factor? 100 individuals/km2 50...
we covered quite a bit regarding health, illness, culture, and how these variables are viewed with...
The main features of chordates. How can they be described according to examples of representative species,...
Evolutionarily, protochordates may be intermediate animals between invertebrates and vertebrates. Imagine that a scientist is testing...
What would be needed to regrow a human limb in the lab to later be transplanted...
Explain how neurons and neurotransmitters are involved in the completion of learning a foriegn language. Specifically,...
Is the tubular-dorsal nervous system of chordates associated with radial or lateral symmetry? How does that...
1)The gastric protease, __________ secreted by the _________ cells lining the gastric pouch is important in...
What is reciprocal altruism? What is kin selection? How does kin selection increase an individual’s success...
Evolutionarily, protochordates may be intermediate animals between invertebrates and vertebrates. Imagine that a scientist is testing...
Is the tubular-dorsal nervous system of chordates associated with radial or lateral symmetry? How does that...
1. Which of the following is true of enzyme catalyzed reactions? a. Reaction rates are temperature dependent b. Reaction...
Evolutionarily, protochordates may be intermediate animals between invertebrates and vertebrates. Imagine that a scientist is testing...
You have the great fortune to have been given a miniature dragon. These dragons are prolific...
Please describe a torpedo model of RNA pol II transcription termination and explain why autocatalytic cleavage...
How can the symmetry and the nervous system be described in echinoderms?
can someone translate these mRNA sequences into proteins 5' AUGGGGAAAUUUUUUAUAGAGAGGUAA 3' 5' GACAAUGGGGAAAAUAAGAUUUAAGACGUGGUGA 3' 5' ACAUCAGGGCAUGAUAUAUAUAUGCCAACACGAGUGGUGGUGGUAA...
For which disease active and passive immunization is given simultaneously? Explain how effective this strategy would...
What type of virus is most likely to be transmitted by vaccination needles, acupuncture tools or...
Streptomyces griseus is a Gram-positive bacterial species that produces the antibiotic Streptomycin, a broad-spectrum Aminoglycoside. Early...
‹
1
2
...
95
96
97
98
99
100
101
...
124
125
›
ADVERTISEMENT
Need Online Homework Help?
Get Answers For Free
Most questions answered within 1 hours.
Ask a Question
ADVERTISEMENT
Active Questions
Why does the author say the freedmen’s Bureau “ did the work of Hercules?”
asked 9 minutes ago
the text file is given but extremely long do i would appreciate the just the code...
asked 35 minutes ago
Write the query that lists the PID, FirstName, LastName, MajorCode, and MajorName of every student. Write...
asked 35 minutes ago
I am to create three different versions of the following C program code below that implements...
asked 43 minutes ago
Name two methods by which hexylamine can be seperated from benzoic acid.
asked 52 minutes ago
Prove that e is not bridge if and only if e is in a cycle. (graph...
asked 59 minutes ago
Explain how to implement online orders. What software is available, does/can it communicate with payment systems...
asked 59 minutes ago
2. A. Put the following set of data into a frequency distribution; include both absolute and...
asked 1 hour ago
In a differential amplifier, the noninverting input is 3cos(600t + 45°) mV and the inverting input...
asked 1 hour ago
Write a function called isLowerCase that takes as a parameter a char and returns a boolean...
asked 1 hour ago
Compare and contrast a “web service” and an SaaS solution within the context of cloud computing
asked 1 hour ago
The vertical cross-section of a nuclear power plant's cooling tower is in the shape of a...
asked 1 hour ago