JustAAA
Home
Questions
Share
Post a Question (with Answer)
Coins
Ask a Question
Log In
Sign Up
Home
/
Biology Questions
Search
Biology Questions
A. Consider a diploid organism such as ourselves. If a phenotype is only present when a...
Considering two traits, an individual that is heterozygous for both genes is crossed with an individual...
#1. Yucca (cassava) is a chemical form of sun’s energy in plant. True or False? #2....
#1. Stage 3 to 4 cancer cells are vicious in that they use up most glucose...
the process used by cells like white blood cells to engulf microorganisms will pseudopods is a....
#1. When an animal dies and rots, this is a good example of First law of...
Human genes are routinely expressed in bacteria to produce clotting factors, hormones, etc. Which of the...
Unsuitable for Online? Can you think of any courses you could not envision being putting online...
24. For the given alignment of the sequences the most distinct species are Sp1 AACGTTACATGGTT Sp2...
#1. Normal cells can survive on ATP from glycolysis very well. True or False? #2. Stage...
15. In the given sequence, aaccggtaaacaagtccccaaacccactagtccctttgaaaaaggg The gene you are interested has one palindromic site for...
Hi,regarding to how dominant gene alleles and recessive gene alleles determine expression of single-gene traits.. I...
Explain how the organism of a blood donor would respond to providing 500 ml of blood....
What are two micro-scale methods by which the epigenome can alter phenotypic expression?
Sex-linked crosses 4. Hemophilia is an X-linked disease, meaning that the gene that causes the disease...
How many STR(short tandem repeats) loci are required to assist in solving a crime in a...
16. What is the basic strategy used by snRNPs - how specific sites arerecognized and how...
It was all over the news this morning (March 29, 2018) that a new cancer “vaccine”...
Demonstrate ability to apply critical thinking and clinical judgment when practicing in the team leader /...
which microbes will grow on the tsa media and explain
appraise the role of water in the life cycles of vascular plants
compare and contrast the life cycle of bryophytes and ferns
Now, for each of the substances below, consider the impact of each substance on cellular respiration....
Barry Hoopengardner conducted an exhaustive survey of A to I RNA editing in Drosophila, and found...
Which of these terms best describes foods that contain carcinogens as the result of cooking method...
Paternal imprinting of the Igf2r locus is established by differential methylation of DNA in the second...
Most organelles are surrounded by a membrane that is A. Rigid because the phospholipids are physically...
Describe 4 stages of chronic renal failure
Describe a scenario in which the microbial carbon and nitrogen cycles are linked due to nutrient...
You are a newly hired epidemiologist in the state of MA during the COVID 19 crisis...
A 45-year-old woman named Christine is measured as having the following skinfold thicknesses on the right...
why does Shubin write so much about neck fossils in your inner fish book?
Make an algorithm to identify the following species E.coli Shigella Klebsiella Citrobacter Serratia Enterobacter Yersinia Salmonella...
What effect does DNA association with histone cores have on compaction of the DNA?
A species is a difficult thing to define, but there are some parameters. The mouse lemurs...
Use the following vocabulary words to fill in the blanks in the questions below. Each answer...
A - Interpret the changes in TSI and LIA medium (slant surface and butt) and describe...
What is the international community's response to deforestation and the loss of biological diversity? Please give...
What is the functional organization of the motor cortex?
1. Is the emphasis in early development on growth or differentiation? 2. Why is your answer...
What are the important clinical implications of blood or cerebrospinal fluid that tests positive for microbes?...
8. You are preparing a 50mL culture of E. coli in LB broth containing the antibiotic...
1. Which of the following is true about binary fission? Group of answer choices A the...
Compare and contrast Interference with Exploitative competition and then tell me a little bit about the...
What is nice conservationism and what do we often look at when defining this variable? With...
4) Which enzymes serve as virulence factors for MRSA? A) Catalase B) Coagulase C) Hemolytic enzymes...
Write an review paragraph of “raging bull” movie.
1. Which of the following is NOT true of Genetic drift: A. It occurs when no...
Write a discussion question relating to the role of normal microbiota in innate immunity.
is this a good description and can you answer question at the end? Would you add...
A) How many protons are required for ATP synthase to rotate 360 degrees? Explain! B) How...
Describe the two mechanisms in which B cells can become activated; Once activated, do they both...
1.When a protein binds to DNA at a site defined by a particular nucleotide sequence, with...
Acute anxiety can be most effectively treated with a. tricyclic antidepressants b. cognitive behavior therapy c....
1. What is anaerobic respiration and what is aerobic respiration? And what are their differences? 2....
Why stromatolites began to decline in diversity and abundance about 700 million years ago?
A non-renewable resource is (a) nonrenewable nonconventional energy source (b) nonrenewable conventional energy source (c) renewable...
Drosohpila Punnet Square of Crosses Make Punnet Squares of the following crosses and explain why the...
What are common sources of infectious diseases that can be found In your community?How can the...
1. A red blood cell is placed into an environment containing 30% sucrose solution. Is the...
how do you know that TAC= tyrosine or GCC=Alanine.? Is there an existing table for that?
Describe antigen processing .How does the process differ from endogenous and exogenous antigens? (20 marks)
Consider obligate anaerobes, facultative anaerobes, and aerotolerant anaerobes. In what way are they all similar? In...
In the most scientific language, explain the evidence for the claim that Achaeans and eukaryotes are...
Briefly discuss the two primary characteristics of the adaptive immune system.
explain why some microorganisms that belong to the normal microbiota can become pathogenic. Please provide an...
How does a butterfly kiss feel? What sequence of neuronal events makes the feeling happen?
Synthesis of DNA begins at the: a. transposon. b. start codon. c. promoter. d. origin of...
A man is exposed to a virus. The virus breaks through the body's first and second...
Describe the anaerobic food web and explain what sensitivities are expected for an anaerobic digester producing...
5.1 What are important calculations required to measure an epidemic?(10 marks) 5.2 Discuss the History of...
Can I have eight to ten sentences (paragraph form) describing of the Vitis aestivalis × V....
Calculate the mass of 1 mole of the following compounds ( round each element to nearest...
Can I have eight to ten sentences (paragraph form) describing of the Parthenocissus inserta (ticket cricket)...
Why might the number of introns in a gene be different between plant species? What features...
Match the following terms with their correct definitions listed below. Terms ...
5: chloroplast kept in the dark can continue to make sugar is provided with A: NADPH,...
24. Determine whether the following factors are density-dependent or density-independent. Drought Disease Temperature Low pH Prey...
write two paragraphs about Enterococcus faecium. please use own simple words and do not copy from...
sex-influenced characteristics are found on the Y chromosome. true or false
‹
1
2
...
52
53
54
55
56
57
58
...
124
125
›
ADVERTISEMENT
Need Online Homework Help?
Get Answers For Free
Most questions answered within 1 hours.
Ask a Question
ADVERTISEMENT
Active Questions
For the following sample: 2 2 4 1 3 2 1 2 Calculate the range and...
asked 2 minutes ago
The following algorithm takes as input an array, and returns the array with all the duplicate...
asked 5 minutes ago
In "Learning to Read," Malcolm X tells us that he learned to read by teaching himself....
asked 6 minutes ago
Suppose a ten-year, $ 1 comma 000$1,000 bond with an 8.6 %8.6% coupon rate and semiannual...
asked 18 minutes ago
Donald and Gloria Bowden hosted a cookout at their home in South Carolina, inviting mostly business...
asked 21 minutes ago
What is the MOST important consideration when establishing metrics for reporting to the information security strategy...
asked 21 minutes ago
At what temperature is the reading on the Fahrenheit scale the same as the reading on...
asked 22 minutes ago
The city Newark in New Jersey is starting to become a Metropolis. What are some predictions...
asked 23 minutes ago
Differentiate between Windows 32bit and 64bit.
asked 23 minutes ago
Q) What is the relationship between the output speed and the input voltage of a DC...
asked 24 minutes ago
A 99% confidence interval estimate of the proportion of a population having a particular characteristic is...
asked 27 minutes ago
the difference between generation - x and millennial's on emotional intelligence
asked 41 minutes ago