JustAAA
Home
Questions
Share
Post a Question (with Answer)
Coins
Ask a Question
Log In
Sign Up
Home
/
Biology Questions
Search
Biology Questions
1. Receptor A and Receptor B are both G-protein coupled receptors (GPCRs), expressed in the same...
Provide an overview of the survival strategies used by microorganisms (20marks)
The PCR products are a certain length due to: A) The DNA breaking off B) Restriction...
We know that red blood cells are eliminated in the spleen thanks to macrophages. But what...
Identify which tree has a compound leaf and which tree has a simple leaf between Japanese...
Which of the following is NOT true of the Drosophila bicoid gene? The bicoid gene encodes...
A researcher identifies a mutation in rats he calls "zigzag" that causes the development of a...
1. Assume that there is a single gene, w, that determines flower color in runner beans....
Are Japanese Pagoda tree and English oak deciduous or evergreens?
With respect to newly synthesized secreted proteins describe how they are sorted and transported through the...
You are asked to purify a hexokinase. Discuss the parameters you would consider in sourcing and...
1. Common rats (Rattus norvegicus) in tropical areas breed continuously throughout the whole year. The instantaneous...
1. Describe the benefits and drawbacks of each of the three main nitrogenous wastes that are...
what are hox genes and their functions?
The pancreatic acinar fluid closely resembles plasma in its tonicity and its concentration of various ions....
how does human behavior suggest innate evolved mechanisms
Animal viruses may be enveloped or non-enveloped. What steps does having the envelope change and how...
Complete translation of an mRNA to a protein can take approximately 2 minutes to complete. A...
Your friend is studying the effects of a mutation in the ORF of a gene. The...
What is an advantage of performing a series of dilutions vs. a simple dilution?
If the PCR reaction does not have the GAPDH band, can you use your data to...
Procedure 1. Use the permanent marker to label the plastic bottles 1 and 2. 2. Use...
Select the correct answer. Question 1: The number of molecules with which an enzyme reacts is...
Factors that impact the incubation period of a disease include all of the following EXCEPT: a....
You’ve discovered a new gene that you think is mutated in muscular dystrophy. Describe the methods...
You’re studying cellular signaling through G-Protein Coupled Receptors (GPCRs). Specifically you’re working on a pair of...
what happens when calcium increases in blood What gland is activated and the hormone that is...
Name one vein involved with the heart circulatory system
As the floodwaters recede in the Okavanga river, predict how some of the biological interactions might...
Lab reporton Human body proportion experiment, in report analyze he result of a human body proportion...
A man and a woman who are both carriers of cystic fibrosis have had three...
Please choose the true statement such that an ionic salt bridge can be formed between the...
What are the qualifiers used with the detachment root operations?
Which method was used to solve the phase problem of the protein [ Concanavalin A ]...
Nitrogen is usually the growth-limiting nutrient in the ecology of higher organisms and their biomes (...
You discover a new rodent and decided to study two traits; curly tail (c) recessive to...
A buffer can be made from Citric Acid and Sodium Citrate Monobasic. What molar ratio of...
In continuous exponential growth, the value of dN/dt – Group of answer choices: increases due to...
Which are components of a PCR reaction? Check All That Apply RNA primers Dideoxyribonucleotides DNA ligase...
1. Define CFU. 2 . Define TFTC. What is the problem with using plates considered to...
6. How do analogous structures arise in different species? A) A basic structure inherited from a...
What evidence can you give supporting the statement that “white rot evolved after the Carboniferous period...
QUESTION 1 A CLIENT HAS A BLOOD PRESSURE OF 120/80 mmHg. The AORTIC VALVE WILL OPEN...
What are the gram type and shape of C.Xerosis?
NOVA BECOMING HUMAN 1) Why do researchers suspect that Sahelanthropus was more likely a human ancestor,...
TACAA(A)TCTCATTGTATAGGA 1) mRNA produced and the amino acid it codes for 2) suppose a mutation occurs...
Explain how endospore-forming bacteria could cause a scientist to believe in spontaneous generation.
Using the table below, please calculate the proportion of the risk of having a car accident...
Will the size of a piece of potato change when you put it in isotonic, hypotonic...
PLEASE EXPLAIN WHY THE OTHER ANSWERS WOULD BE INCORRECT> 4. Heritability describes the a. genetic composition...
Why is the uptake of plasmids in natural systems important?
discuss the levels,role and importance of regulating gene expression within bacteria.
A) Outline the steps and features of Sanger DNA sequencing and compare with Next Generation Sequencing...
1. How is oxaloacetate transported across the inner mitochondrial membrane? 2. List several metabolic fates of...
Discuss the two-times rule applied to APC groups. What is an APC?
Describe why pH has an effect on the tenderness of meat
which molecule changes the expressuon of its levels allowing t effectors to move out of lymph...
What is anaerobic respiration? When is it needed and how does this relate to oxygen debt?
Keto diet, what is the science behind this diet? How did it begin? Are the findings...
In Drosophila, cut wings are controlled by a recessive sex-linked allele (ct), and fuzzy body is...
Discuss the appearance of the bacterial cells if the primary stain was omitted from the Gram...
Why does Collagen make meat tougher?
which of these factors can act as environmental selective pressure on individuals in a population? Pathogens...
Anthony, a 26-year-old married male is seen by his physician complaining of burning, blister-like lesions near...
Your friend says that humans have evolved from apes. How would you respond to that statement?...
Cindy is a thirty-five-year-old volunteer in an inner-city church-sponsored preschool program. The mothers of the neighborhood...
How the Bee's P450 activity works in detoxifying the body?
From a biology perspective, why is genetic diversity so important?
Can you eplain to me why it takes more than one mutation for a cell to...
DNA can be crosslinked, which forms covalent bonds between the two strands. Describe one reason this...
Aspirin can alter the function of the hypothalamus and decrease body temperature when you have a...
why do polar bodies form?
5' AGTTGTATAGAAAACTGCGAA 3' What DNA sequence (give as 5' to 3') would be formed by replicating...
In the late stages of infection of a bacterial cell by the bacteriophage T4, transcription of...
== Transposons Define a transposon: What is transposition? Read the close-up box on page 218, 10th...
which of the following is not true of typical quantitative traits? a. They are influenced by...
How can gene expression be controlled
Quétel Claude. 1990. History of Syphilis. The Johns Hopkins University Press. Baltimore, Maryland. 1. Describe in...
TFIIH phosphorylates the CTD of RNA polymerase II at position #5 in the repeation heptapeptides. Which...
Carry out your own DNA extraction experiment from plant cells Do not forget to document everything...
‹
1
2
...
46
47
48
49
50
51
52
...
124
125
›
ADVERTISEMENT
Need Online Homework Help?
Get Answers For Free
Most questions answered within 1 hours.
Ask a Question
ADVERTISEMENT
Active Questions
4. Write a Java program to test if the first and the last element of an...
asked 10 minutes ago
You want to find the standard deviation of the musical aptitude scores for a group of...
asked 17 minutes ago
A Carnot engine operates between 550°C and 20°C baths and produces 300 kJ of energy in...
asked 24 minutes ago
In a clinical trial,18 out of 828 patients taking a prescription drug daily complained of flulike...
asked 31 minutes ago
1) A 500.00 mL buffer solution contains 0.100 M in acetic acid (HC2H3O2) and 0.250 M...
asked 46 minutes ago
Explain why someone might be attracted ethical relativism and moral nihilism. Is one of these theories...
asked 46 minutes ago
An assembly component A uses 2 units of another component B. Component A has the planned...
asked 54 minutes ago
PLEASE ANSWER ALL PARTS AND SHOW ALL WORK Unless otherwise specified, please use alpha = 0.05....
asked 59 minutes ago
WRITE A PROGRAM ON PURE PYTHON WITHOUT USING ANY LIBRARIES LIKE PANDAS AND NUMPY - Read...
asked 1 hour ago
Question 3 What major advantage does NoSQL database systems have? NoSQL database systems data is highly...
asked 1 hour ago
Provide examples of how social science researchers study the problem of human trafficking.
asked 1 hour ago
A company that produces an expensive stereo component is considering offering a warranty on the component....
asked 1 hour ago