JustAAA
Home
Questions
Share
Post a Question (with Answer)
Coins
Ask a Question
Log In
Sign Up
Home
/
Biology Questions
Search
Biology Questions
Many bacteria are relatively small. Why could it be an advantage to be a small cell...
Do gram positive bacteria form endotoxins? Explain the answer
Parkinson’s disease (characterized by tremors and progressive rigidity of limbs) is caused by degeneration of brain...
Which cranial nerve has the highest number of branches? (a) vagus nerve (b) trigeminal nerve (c)...
Sympathetic nervous system induces (a) secretion of digestive juices (b) heart beat (c) secretion of saliva...
11. (short answer) What is the significance of negative feedback? Positive feedback? Which is the more...
The junction between the axon of one neuron and the dendrite of the next is called...
In the chemistry of vision in mammals, the photosensitive substance is called (a) rhodopsin (b) melanin...
Function of iris is to (a) move lens forward and backward (b) refract light rays (c)...
Third ventricle of brain is also known as (a) metacoel (b) rhinocoel (c) paracoel (d) diacoel.
Which of the following cranial nerves can regulate heart beat? (a) X (b) IX (c) VIII...
Evolutionary history of an organism is known as (a) ontogeny (b) phylogeny (c) ancestry (d) paleontology
Which of the following is an example of negative feedback loop in humans? (a) secretion of...
Flagella of prokarvotic and eukaryotic cells differ in (a) type of movement and placement in cell...
The questions below refer to the 1858 publications by Darwin and Wallace that first announced their...
Red (ginger) hair is due to a recessive allele at the MC1R gene. Your friend has...
H.J. Muller had received Nobel Prize for (a) his studies on Drosophila for genetic study (b)...
Evolution You work for a forestry department. Your colleague asks your opinion of a proposal to...
1. How does basic chemistry differ within a particular species of organism? A. Certain chemicals may...
The causative agent of mad-cow disease is a (a) virus (b) bacterium (c) prion (d) worm
Which one of the following is not correctly matched? (a) Glossina palpalis – Sleeping sickness (b)...
Cancerous cells can easily be destroyed by radiations due to (a) rapid cell division (b) lack...
Which is showing accurate pairing? (a) syphilis – Treponema pallidum (b) AIDS – Bacillus conjugalis (c)...
Which is the most infectious disease? (a) hepatitis-B (b) AIDS (c) cough and cold (d) malaria.
Typhoid fever is caused by (a) Shigella (b) Escherichia (c) Giardia (d) Salmonella.
Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Restriction digest B: ATTGAATTCCGGTTAGCTTTACAATTCCGCCATATGCGCAATTGGAATTCC 1. Now compare the same region of DNA...
Which disease of man is similar with cattle’s, bovine spongiform encephalopathy? (a) encephalitis (b) Jacob-cruitzfeit disease...
Botulism caused by Clostridium botulinum affects the (a) lymph glands (b) central nervous system (c) spleen...
Which one of the following diseases is due to an allergic reaction? (a) enteric fever (b)...
Which one of the following does correctly match a sexually transmitted disease with its pathogen? (a)...
Using a cancer with a hereditary component as an example, explain how aninherited gene abnormality increases...
Nicotine acts as a stimulant, because it mimics the effect of (a) testosterone (b) dopamine (c)...
You are working with a bacteria that has a generation time of 20 minutes. You inoculate...
1. Which statement about enzymes is true? A. One enzyme can catalyze many different types of...
Which of the following statement is correct for node of Ranvier of nerve? (a) neurilemma is...
Which of the following statements is the characteristic of human cornea? (a) secreted by conjuctiva and...
Depolarization of axolema during nerve conduction takes place because of (a) equal amount of Na+ and...
In the chemistry of vision in mammals, the photosensitive substance is called (a) rhodopsin (b) melanin...
Which hormone causes dilation of blood vessels, increased oxygen consumption and glucogenesis? (a) glucagon (b) ACTH...
Which one of the following is not a secondary messenger in hormone action? (a) cAMP (b)...
Which one of the following pairs correctly matches a hormone with a disease resulting from its...
MSH is secreted by (a) anterior lobe of pituitary (b) middle lobe of pituitary (c) posterior...
Secretion of progesterone by corpus luteum is initiated by (a) testosterone (b) thyroxine (c) MSH (d)...
Hormones thyroxine, adrenaline and the pigment melanin are formed from (a) tyrosine (b) proline (c) tryptophan...
can you think of any reason why it might be more advantageous for the external epithelium...
Many metabolic disorders have similar symptoms because of the connections between pathways. The more severe form...
Write a brief outline of the mechanisms in which DNA is used to generate protein.
Sympathetic nervous system induces (a) secretion of digestive juices (b) heart beat (c) secretion of saliva...
The vagus nerve is the cranial nerve numbering (a) 7 (b) 5 (c) 10 (d) 9.
Third ventricle of brain is also known as (a) metacoel (b) rhinocoel (c) paracoel (d) diacoel.
Red and white blood cells develop from a common hematopoietic stem cell, which is large and...
TOPIC- EFFECT AND VEGETABLES ANTIOXIDANTS ON TOTAL ANTIOXIDANT CAPACITY OF BLOOD PLASMA QUESTION- WHAT SIGNIFICANT DETAIL...
Why in an immunostaining procedure for a specific antigen do you normally use two antibodies sequentially?
Are extrinsic muscle pumps found only in animals with rudimentary circulatory systems? If so, why? If...
Why in an immunostaining procedure for a specific antigen do you normally use two antibodies sequentially?...
What are cells and their structural and functional components? How do cells normally function? How might...
Bioremediation can come in many forms. There are many approaches that can be taken to address...
In prokaryotes, repressors work in all of the following ways EXCEPT: A. Interacting with RNA polymerase...
Darwin himself poses a question in the first page of this reading: "How have all those...
6. Which of the following statements correctly describes intermediate filaments? a. They are the only cytoskeletal...
An abnormal human male phenotype involving an extra X-chromosome (XXY) is a case of (a) Edward’s...
Albinism is a congenital disorder resulting from the lack of which enzyme? (a) tyrosinase (b) xanthine...
Mitotic spindle is mainly composed of which protein? (a) actin (b) myosin (c) actomyosin (d) myoglobin.
Which statement best explains the evolutionary advantage of meiosis? (a) meiosis is necessary for sexual reproduction...
In meiosis, the daughter cells differ from parent cell as well as amongst themselves due to...
1. Compare and contrast the cell wall in archaebacteria and eubacteria.
what in the crucial geochemical elements to have life in other planets?
Describe the chemical properties of the sequence blocks in the polypeptide shown: DKEKRESNQYTMLVFI
how can we analysis and inverstigate Stromatolites rock to find out about its biogenicity (auuming if...
Concentration of urine depends upon which organ? (a) Bowman’s capsule (b) length of Henle’s loop (c)...
Organisms which obtain energy by the oxidation of reduced inorganic compounds are called (a) photoautotrophs (b)...
The ultimate respiratory substrate, yielding maximum number of ATP molecules, is (a) glycogen (b) ketogenic amino...
Why might a Punnett square not be useful for crosses with more than 1 gene?
RNA retroviruses such as HIV discharge both strands of RNA and molecules of reverse transcriptase into...
Please summarize the below article in approximately 100 words: BURIAL CUSTOMS AND HUMAN REMAINS IN ARCHAEOLOGY...
Please summarize the below article in approximately 100 words: Monumental function in British Neolithic burial practices...
In squirrels, allele T1 results in tufted ears, whereas allele T2 results in hairless ears. How...
DNA replication is always 5' to 3'. Explain what 5' to 3' means with respect to...
Adaptations: Select one: a. are built from genetic mistakes. b. cause an organism to be well...
The “older-brother” effect suggests that male homosexuality is a facultative adaptation: Select one: a. true. b....
‹
1
2
...
10
11
12
13
14
15
16
...
124
125
›
ADVERTISEMENT
Need Online Homework Help?
Get Answers For Free
Most questions answered within 1 hours.
Ask a Question
ADVERTISEMENT
Active Questions
Language:C++ HAS TO WORK IN VISUAL BASIC I have errors on line 102 "expression must have...
asked 1 minute ago
When an ion-selective electrode for X was immersed in 0.0760 M XCl, the measured potential was...
asked 6 minutes ago
A study showed that 64.7% of occupants involved in a fatal car crash wore seat belts....
asked 7 minutes ago
The Federal government is considering a controversial plan to monitor the mentally ill as a way...
asked 7 minutes ago
int reversed_number(int number){ int reversed = number; //TODO: if input is 12345, return 54321 return reversed;...
asked 8 minutes ago
Adding large numbers with linked list Requirement - in C++ - use file for the input...
asked 18 minutes ago
4) A statistics professor is studying the learning styles of college students. The professor would like...
asked 18 minutes ago
Four pirates, Jack, Dusty, Bart, and Will, want to bury their treasure on an island in...
asked 35 minutes ago
C# programming Assume we have a student final exam score lookup table like this: John 40...
asked 41 minutes ago
C# programming Create a class called QuadraticEq that has a custom constructor that takes in a,...
asked 44 minutes ago
Can outdated or misaligned Information Systems negatively affect your job performance, if so, how?
asked 46 minutes ago
0. Introduction. In this laboratory assignment, you will write a Python class called Zillion. The class...
asked 55 minutes ago