JustAAA
Home
Questions
Share
Post a Question (with Answer)
Coins
Ask a Question
Log In
Sign Up
Home
/
Biology Questions
Search
Biology Questions
The junction between the axon of one neuron and the dendrite of the next is called...
In the chemistry of vision in mammals, the photosensitive substance is called (a) rhodopsin (b) melanin...
Function of iris is to (a) move lens forward and backward (b) refract light rays (c)...
Third ventricle of brain is also known as (a) metacoel (b) rhinocoel (c) paracoel (d) diacoel.
Which of the following cranial nerves can regulate heart beat? (a) X (b) IX (c) VIII...
Evolutionary history of an organism is known as (a) ontogeny (b) phylogeny (c) ancestry (d) paleontology
Which of the following is an example of negative feedback loop in humans? (a) secretion of...
Flagella of prokarvotic and eukaryotic cells differ in (a) type of movement and placement in cell...
The questions below refer to the 1858 publications by Darwin and Wallace that first announced their...
Red (ginger) hair is due to a recessive allele at the MC1R gene. Your friend has...
H.J. Muller had received Nobel Prize for (a) his studies on Drosophila for genetic study (b)...
Evolution You work for a forestry department. Your colleague asks your opinion of a proposal to...
1. How does basic chemistry differ within a particular species of organism? A. Certain chemicals may...
The causative agent of mad-cow disease is a (a) virus (b) bacterium (c) prion (d) worm
Which one of the following is not correctly matched? (a) Glossina palpalis – Sleeping sickness (b)...
Cancerous cells can easily be destroyed by radiations due to (a) rapid cell division (b) lack...
Which is showing accurate pairing? (a) syphilis – Treponema pallidum (b) AIDS – Bacillus conjugalis (c)...
Which is the most infectious disease? (a) hepatitis-B (b) AIDS (c) cough and cold (d) malaria.
Typhoid fever is caused by (a) Shigella (b) Escherichia (c) Giardia (d) Salmonella.
Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Restriction digest B: ATTGAATTCCGGTTAGCTTTACAATTCCGCCATATGCGCAATTGGAATTCC 1. Now compare the same region of DNA...
Which disease of man is similar with cattle’s, bovine spongiform encephalopathy? (a) encephalitis (b) Jacob-cruitzfeit disease...
Botulism caused by Clostridium botulinum affects the (a) lymph glands (b) central nervous system (c) spleen...
Which one of the following diseases is due to an allergic reaction? (a) enteric fever (b)...
Which one of the following does correctly match a sexually transmitted disease with its pathogen? (a)...
Using a cancer with a hereditary component as an example, explain how aninherited gene abnormality increases...
Nicotine acts as a stimulant, because it mimics the effect of (a) testosterone (b) dopamine (c)...
You are working with a bacteria that has a generation time of 20 minutes. You inoculate...
1. Which statement about enzymes is true? A. One enzyme can catalyze many different types of...
Which of the following statement is correct for node of Ranvier of nerve? (a) neurilemma is...
Which of the following statements is the characteristic of human cornea? (a) secreted by conjuctiva and...
Depolarization of axolema during nerve conduction takes place because of (a) equal amount of Na+ and...
In the chemistry of vision in mammals, the photosensitive substance is called (a) rhodopsin (b) melanin...
Which hormone causes dilation of blood vessels, increased oxygen consumption and glucogenesis? (a) glucagon (b) ACTH...
Which one of the following is not a secondary messenger in hormone action? (a) cAMP (b)...
Which one of the following pairs correctly matches a hormone with a disease resulting from its...
MSH is secreted by (a) anterior lobe of pituitary (b) middle lobe of pituitary (c) posterior...
Secretion of progesterone by corpus luteum is initiated by (a) testosterone (b) thyroxine (c) MSH (d)...
Hormones thyroxine, adrenaline and the pigment melanin are formed from (a) tyrosine (b) proline (c) tryptophan...
can you think of any reason why it might be more advantageous for the external epithelium...
Many metabolic disorders have similar symptoms because of the connections between pathways. The more severe form...
Write a brief outline of the mechanisms in which DNA is used to generate protein.
Sympathetic nervous system induces (a) secretion of digestive juices (b) heart beat (c) secretion of saliva...
The vagus nerve is the cranial nerve numbering (a) 7 (b) 5 (c) 10 (d) 9.
Third ventricle of brain is also known as (a) metacoel (b) rhinocoel (c) paracoel (d) diacoel.
Red and white blood cells develop from a common hematopoietic stem cell, which is large and...
TOPIC- EFFECT AND VEGETABLES ANTIOXIDANTS ON TOTAL ANTIOXIDANT CAPACITY OF BLOOD PLASMA QUESTION- WHAT SIGNIFICANT DETAIL...
Why in an immunostaining procedure for a specific antigen do you normally use two antibodies sequentially?
Are extrinsic muscle pumps found only in animals with rudimentary circulatory systems? If so, why? If...
Why in an immunostaining procedure for a specific antigen do you normally use two antibodies sequentially?...
What are cells and their structural and functional components? How do cells normally function? How might...
Bioremediation can come in many forms. There are many approaches that can be taken to address...
In prokaryotes, repressors work in all of the following ways EXCEPT: A. Interacting with RNA polymerase...
Darwin himself poses a question in the first page of this reading: "How have all those...
6. Which of the following statements correctly describes intermediate filaments? a. They are the only cytoskeletal...
An abnormal human male phenotype involving an extra X-chromosome (XXY) is a case of (a) Edward’s...
Albinism is a congenital disorder resulting from the lack of which enzyme? (a) tyrosinase (b) xanthine...
Mitotic spindle is mainly composed of which protein? (a) actin (b) myosin (c) actomyosin (d) myoglobin.
Which statement best explains the evolutionary advantage of meiosis? (a) meiosis is necessary for sexual reproduction...
In meiosis, the daughter cells differ from parent cell as well as amongst themselves due to...
1. Compare and contrast the cell wall in archaebacteria and eubacteria.
what in the crucial geochemical elements to have life in other planets?
Describe the chemical properties of the sequence blocks in the polypeptide shown: DKEKRESNQYTMLVFI
how can we analysis and inverstigate Stromatolites rock to find out about its biogenicity (auuming if...
Concentration of urine depends upon which organ? (a) Bowman’s capsule (b) length of Henle’s loop (c)...
Organisms which obtain energy by the oxidation of reduced inorganic compounds are called (a) photoautotrophs (b)...
The ultimate respiratory substrate, yielding maximum number of ATP molecules, is (a) glycogen (b) ketogenic amino...
Why might a Punnett square not be useful for crosses with more than 1 gene?
RNA retroviruses such as HIV discharge both strands of RNA and molecules of reverse transcriptase into...
Please summarize the below article in approximately 100 words: BURIAL CUSTOMS AND HUMAN REMAINS IN ARCHAEOLOGY...
Please summarize the below article in approximately 100 words: Monumental function in British Neolithic burial practices...
In squirrels, allele T1 results in tufted ears, whereas allele T2 results in hairless ears. How...
DNA replication is always 5' to 3'. Explain what 5' to 3' means with respect to...
Adaptations: Select one: a. are built from genetic mistakes. b. cause an organism to be well...
The “older-brother” effect suggests that male homosexuality is a facultative adaptation: Select one: a. true. b....
Natural selection favors certain alleles. What is the most general specification of the kind of alleles...
Studies have linked high levels of testosterone to increased risks of prostate cancer, but testosterone also...
Regarding human pair-bonding which of the following seems to be true? Select one: a. Comparisons with...
2. What is adaptive radiation? A. The ability of a species to survive in all environments....
1. How does basic chemistry differ within a particular species of organism? A. Certain chemicals may...
what is the taxonomy of streptococcus pyogenes? and what is its morphological and structural characteristics
‹
1
2
...
8
9
10
11
12
13
14
...
124
125
›
ADVERTISEMENT
Need Online Homework Help?
Get Answers For Free
Most questions answered within 1 hours.
Ask a Question
ADVERTISEMENT
Active Questions
Write a one to two page paper: Describe how self-concept, self-understanding, and self-esteem change in adolescence.
asked 17 minutes ago
7.) Your participant is 5’8” and weighs 178 lbs. They completed an exercise bout using arm...
asked 37 minutes ago
Assume that the price and the demand are both positive. Use the price-demand equation, x= f(p)= √(1600-2p^2)...
asked 1 hour ago
aBankruptcy: Moral, Amoral, or Immoral? Is it unethical to avoid paying one’s debts by going into...
asked 1 hour ago
Pick a specific leader facing an issue in the last six months that you can analyze...
asked 1 hour ago
For the past several years, Joanna and her two sisters have taken turns claiming a dependency...
asked 1 hour ago
Assume that you developed an e-commerce site for the purpose of doing business. As a continuation...
asked 2 hours ago
To keep her dog from running away while she talks to a friend, Susan pulls gently...
asked 2 hours ago
Problem 2. (Chapter 11: The Storage and Handling System) Under what general circumstances is private warehousing...
asked 2 hours ago
Outline the types of costs that would be included in the total cost of ownership of...
asked 2 hours ago
Post a brief description of an example of long-term memory loss that you have experienced. Then...
asked 2 hours ago
A driver is traveling 120 km/h on a road with a negative 1% grade. There is...
asked 2 hours ago