Question

What is the nominal value of Dmax for 6MV and 10MV? please show work.

What is the nominal value of Dmax for 6MV and 10MV?

please show work.

Homework Answers

Answer #1

Dmax is the depth at which maximum dose ( i.e 100 %) of the incident high energy X-ray beams is delivered inside a medium. Beyond that the energy is absorbed in the medium. This term is mainly used in radiotherapy treatment where the medium is human tissue.

Dmax is a parameter that depends on the energy of the primary photon. Ideally it independent of other parameters such as source to skin distance (SSD) and field size.

Dmax values for 6MV and 10MV photons are as follows:

6MV - 1.5 cm

10MV -   2.5 cm

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
Please show work and calculations! thank you! Find a value of the standard normal random variable...
Please show work and calculations! thank you! Find a value of the standard normal random variable z , call it z0, such that the following probabilities are satisfied. P( -2 < z < z0) = 0.9607
Please show work, if completed in Excel, please show details: Practice Question: part a: What is...
Please show work, if completed in Excel, please show details: Practice Question: part a: What is the annual rate of return for this mutual fund: price $25 (January 1),12/31 price $22.50 (December 31), annual dividend $1.25? part b: What is the total rate of return to an investor who buys a bond for $1,100 when the bond has a 9% coupon rate and five years remaining until maturity and then sells the bond after one year for $1,085?   *** for...
Please show formula and work and calculations! thank you! Find a value of the standard normal...
Please show formula and work and calculations! thank you! Find a value of the standard normal random variable z ​, call it z0, such that the following probabilities are satisfied. a. P( - z0 ≤ z ≤ 0) = 0.2612 b. P( -3 < z < z0) = 0.9559
Please show all work Present Value and Yield to Maturity. (a) A 15 year coupon bond...
Please show all work Present Value and Yield to Maturity. (a) A 15 year coupon bond with face value $250,000 and a 5% coupon rate has a yield to maturity i = 0.06. What is the value of the annual coupon payment? What is the price of this coupon bond? Answer: C = $12,500 and PCB = $225,719.39 (b) A 10 year coupon bond with a 4% coupon rate and yield to maturity i = 0.05 sells for a price...
Please show work, thank you in advance :) What is the present value of a semi-annual...
Please show work, thank you in advance :) What is the present value of a semi-annual ordinary annuity payment of $7,000 made for 12 years with a required annual return of 5%? $ 65,145 $128,325 $125,195 (correct) $ 62,043 You deposit $10,000 in a bank and plan to keep it there for five years. The bank pays 8% annual interest compounded continuously. Calculate the future value at the end of five years. $14,693 $15,000 $14,918 (correct) $14,500 What is the...
PLEASE SHOW THE WORK In a normal model with a mean of 100 and standard deviation...
PLEASE SHOW THE WORK In a normal model with a mean of 100 and standard deviation of 16, what cutoff value bounds The highest 5%? The lowest 30%? The middle 80%?
PLEASE SHOW WORK AND CALCULATE WITH FORMULAS OR EXPLANATION!! THANK YOU SO MUCH. ( please write...
PLEASE SHOW WORK AND CALCULATE WITH FORMULAS OR EXPLANATION!! THANK YOU SO MUCH. ( please write the formula first so i know the appropriate formula to use thanks!) What is the value in the year 2040 of an $800 a year annuity with the first payment in 2023 and final payment in 2039. The interest rate is 7% p.a. Please show me the line too.
What protein product is encoded for by the DNA sequence: (show all work)   TACCTAAAAACTACTACTACTAGTGTGGAGCCACACCCTAGTTGGCCAATCTATCCCAGGAGCAGGGAGGGCAGGAGCCAGGGCTGGGCATAATAC … Please,...
What protein product is encoded for by the DNA sequence: (show all work)   TACCTAAAAACTACTACTACTAGTGTGGAGCCACACCCTAGTTGGCCAATCTATCCCAGGAGCAGGGAGGGCAGGAGCCAGGGCTGGGCATAATAC … Please, show me the steps on how to read sequence.
Please show all work and place your final answers on the lines. No work means no...
Please show all work and place your final answers on the lines. No work means no credit.(please show work) 3. A trainer claims that he will increase your bench press strength by 25 pounds.  A random sample of 51 people that have worked with the trainer showed a mean bench press strength increase of 23 pounds with a standard deviation of 5 pounds.  Using a significance level of 5%, can you conclude that the trainer’s claim is valid? Null Hypothesis: ____________________            Your Work:...
What is the weighted average cost of capital of General mills ? please show the work,...
What is the weighted average cost of capital of General mills ? please show the work, Thank you! search the data i don't have any
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT