Question

Explain and analyse why shipping cycles are a crucial part of the shipping market mechanism

Explain and analyse why shipping cycles are a crucial part of the shipping market mechanism

Homework Answers

Answer #1

The shipping cycle plays an important part in the shipping market mechanism as it balance the demand for and supply of ships. Shipping cycles in the market are the driving force behind shipping chartering and investment. Market cycles are important for managing the investment in shipping. A ship is costly item in capital equipment, and volume of trade determines the return on investment on shipping. When there is excessive demand, the markets will rewards investors with high rates on the freight until more ships are built. On contrary if excess supply exists, the market will reduce the revenue with low rates on freight until ships are scrapped. Hence the shipping cycle as a mechanism to balance the market and creates a healthy business environment.

Know the answer?
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for?
Ask your own homework help question
Similar Questions
****Describe why it arises, in other words, what part of the endocrine regulatory mechanism is not...
****Describe why it arises, in other words, what part of the endocrine regulatory mechanism is not working properly. ****Explain why the dysfunction leads to the symptoms typically associated with the condition. ****Describe how the condition is treated and why that treatment would be effective. Diabetes insipidus: there are 2 major types of this disease (central and nephrogenic), so make sure to discuss both of them.
Is Alan Greenspan an expert financial analyst and forecaster of future U.S. bond market cycles? Explain.
Is Alan Greenspan an expert financial analyst and forecaster of future U.S. bond market cycles? Explain.
Indicate if you think the RNA sequence below could be part of a riboswitch mechanism and...
Indicate if you think the RNA sequence below could be part of a riboswitch mechanism and explain why. Strand 1: AUGCCAUAGCUUCGAUGGGCAUCGAAGCUAUGGCGAGAUUUCGAAGCUA
Use any of the innovation theory below to analyse and explain why iPhone 1st generation 2007...
Use any of the innovation theory below to analyse and explain why iPhone 1st generation 2007 was successful (Innovation Theories : S-curves, dominant design, punctuated equillibrium, absorptive capacity)
Three amino acids are crucial to the activity of Trypsin: Asp 102, His57, and Ser195. a)...
Three amino acids are crucial to the activity of Trypsin: Asp 102, His57, and Ser195. a) select one of these residues and describe how replacing that residue with a glycine would affect the catalytic mechanism of Trypsin b) Which kinetic parameter (Km, Vmax, Kcat...) would be altered due to the change that u made in part a? Explain.   
Explain why the carbocation intermediate mechanism can lead to the syn and/or anti addition product, but...
Explain why the carbocation intermediate mechanism can lead to the syn and/or anti addition product, but the bromonium ion mechanism can only lead to anti addition product
Explain why both effective international pricing and working capital management are crucial. What does the international...
Explain why both effective international pricing and working capital management are crucial. What does the international manager need to do both alone and in conjunction with managers of other business functions, such as marketing, human resources, and operations, to effectively manage these areas? (600 WORDS)
What Ions are crucial for Action Potential (AP) to be generated? Please explain the sodium/potassium gradient...
What Ions are crucial for Action Potential (AP) to be generated? Please explain the sodium/potassium gradient and why it is important.
Explain accounting cycles and ERPs and how they are related; highlight the use of big data...
Explain accounting cycles and ERPs and how they are related; highlight the use of big data and analytics; please be specific. Discuss why an understanding of systems and accounting cycles might help in understanding, implementing, and using an ERP
Describe the phases and key characteristics of business cycles. Then explain where we are in the...
Describe the phases and key characteristics of business cycles. Then explain where we are in the business cycle right now and why
ADVERTISEMENT
Need Online Homework Help?

Get Answers For Free
Most questions answered within 1 hours.

Ask a Question
ADVERTISEMENT